ID: 927040986

View in Genome Browser
Species Human (GRCh38)
Location 2:19230123-19230145
Sequence GTGTTTCAGGGCATGGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927040981_927040986 2 Left 927040981 2:19230098-19230120 CCTCTGCACTTGGTAGTATTGCA No data
Right 927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG No data
927040976_927040986 27 Left 927040976 2:19230073-19230095 CCCATGATTGATCTTCGCAAATG No data
Right 927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG No data
927040977_927040986 26 Left 927040977 2:19230074-19230096 CCATGATTGATCTTCGCAAATGC No data
Right 927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG No data
927040979_927040986 4 Left 927040979 2:19230096-19230118 CCCCTCTGCACTTGGTAGTATTG No data
Right 927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG No data
927040980_927040986 3 Left 927040980 2:19230097-19230119 CCCTCTGCACTTGGTAGTATTGC No data
Right 927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927040986 Original CRISPR GTGTTTCAGGGCATGGATTT GGG Intergenic
No off target data available for this crispr