ID: 927042392

View in Genome Browser
Species Human (GRCh38)
Location 2:19242439-19242461
Sequence CAAAGTTAGCAATTGTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927042387_927042392 6 Left 927042387 2:19242410-19242432 CCCCATTTGATGGAGGTTTTCGG No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data
927042382_927042392 29 Left 927042382 2:19242387-19242409 CCCATTCTCCTGGAGGCAAGTGT No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data
927042383_927042392 28 Left 927042383 2:19242388-19242410 CCATTCTCCTGGAGGCAAGTGTC No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data
927042389_927042392 5 Left 927042389 2:19242411-19242433 CCCATTTGATGGAGGTTTTCGGG No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data
927042384_927042392 21 Left 927042384 2:19242395-19242417 CCTGGAGGCAAGTGTCCCCATTT No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data
927042391_927042392 4 Left 927042391 2:19242412-19242434 CCATTTGATGGAGGTTTTCGGGA No data
Right 927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927042392 Original CRISPR CAAAGTTAGCAATTGTTGCT TGG Intergenic
No off target data available for this crispr