ID: 927044469

View in Genome Browser
Species Human (GRCh38)
Location 2:19263026-19263048
Sequence GTTCTCCTGAATCACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927044463_927044469 9 Left 927044463 2:19262994-19263016 CCACTTCTTTCCCCAATGTGGCC No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044456_927044469 24 Left 927044456 2:19262979-19263001 CCCCAAGCTCCCCTTCCACTTCT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044455_927044469 25 Left 927044455 2:19262978-19263000 CCCCCAAGCTCCCCTTCCACTTC No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044465_927044469 -2 Left 927044465 2:19263005-19263027 CCCAATGTGGCCCACTGTTCTGT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044460_927044469 14 Left 927044460 2:19262989-19263011 CCCTTCCACTTCTTTCCCCAATG No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044466_927044469 -3 Left 927044466 2:19263006-19263028 CCAATGTGGCCCACTGTTCTGTT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044459_927044469 15 Left 927044459 2:19262988-19263010 CCCCTTCCACTTCTTTCCCCAAT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044464_927044469 -1 Left 927044464 2:19263004-19263026 CCCCAATGTGGCCCACTGTTCTG No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044457_927044469 23 Left 927044457 2:19262980-19263002 CCCAAGCTCCCCTTCCACTTCTT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044461_927044469 13 Left 927044461 2:19262990-19263012 CCTTCCACTTCTTTCCCCAATGT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data
927044458_927044469 22 Left 927044458 2:19262981-19263003 CCAAGCTCCCCTTCCACTTCTTT No data
Right 927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927044469 Original CRISPR GTTCTCCTGAATCACATTGT AGG Intergenic
No off target data available for this crispr