ID: 927053246

View in Genome Browser
Species Human (GRCh38)
Location 2:19349825-19349847
Sequence TGGTTGTTTTGGAGCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927053241_927053246 8 Left 927053241 2:19349794-19349816 CCTGTGTGTGTGTGTGTTCACCC 0: 1
1: 1
2: 18
3: 119
4: 664
Right 927053246 2:19349825-19349847 TGGTTGTTTTGGAGCAACCATGG 0: 1
1: 0
2: 0
3: 13
4: 152
927053240_927053246 9 Left 927053240 2:19349793-19349815 CCCTGTGTGTGTGTGTGTTCACC 0: 1
1: 4
2: 21
3: 175
4: 1016
Right 927053246 2:19349825-19349847 TGGTTGTTTTGGAGCAACCATGG 0: 1
1: 0
2: 0
3: 13
4: 152
927053239_927053246 29 Left 927053239 2:19349773-19349795 CCAAGGGACTAGGAAGGGCACCC 0: 1
1: 0
2: 3
3: 15
4: 149
Right 927053246 2:19349825-19349847 TGGTTGTTTTGGAGCAACCATGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927053246 Original CRISPR TGGTTGTTTTGGAGCAACCA TGG Intergenic
901885029 1:12216708-12216730 GGGTCCATTTGGAGCAACCAGGG + Intergenic
902849861 1:19146495-19146517 TGGTTGCTTTAAAGCAACTATGG - Intronic
902849863 1:19146498-19146520 TAGTTGCTTTAAAGCAACCAGGG + Intronic
904950235 1:34231799-34231821 TGGTTGTTTTGGGGAGAACAAGG - Intergenic
905501463 1:38442592-38442614 TGGTTGTTTTAAAGAAACTAAGG + Intergenic
906498900 1:46325721-46325743 TGATTGATTTGGAGCAAGCAAGG + Intergenic
910331987 1:86084095-86084117 TGGTTATTTTGGTCAAACCATGG - Intronic
910524241 1:88159316-88159338 TGGTTGTATTGAAGCAATGAGGG - Intergenic
911777619 1:101834647-101834669 TGGTAGTTTTAGAGCAACAGAGG - Intronic
913511253 1:119564628-119564650 TTTTTGTTTTGTAGCAACCTTGG + Intergenic
914354049 1:146866559-146866581 TGATTGTTTTTGAGCAAGCCTGG - Intergenic
918416124 1:184310460-184310482 TGTTTGTTTTGGAGAAAGTAAGG - Intergenic
919287709 1:195585509-195585531 TGGTTTTTTTGGAGAAAGTAAGG + Intergenic
920927542 1:210357017-210357039 TGAGTGTTGTGGAACAACCAAGG + Intronic
922872998 1:228918095-228918117 TGTTTTTTTTGGAGCAGACAAGG + Intergenic
1065891161 10:30122472-30122494 TAGTTGTTTAGAAGCAAACATGG - Intergenic
1068876143 10:61998909-61998931 TGTCTCTTTTGGATCAACCAGGG + Intronic
1069096481 10:64265614-64265636 TGTTTGCTTTGGGGCAAACAAGG - Intergenic
1069595905 10:69670049-69670071 TGTTTGTGTTGGAGCAAGGAAGG + Intergenic
1071425567 10:85545702-85545724 TGGTTATTTTTGATAAACCAGGG - Intergenic
1074461735 10:113644451-113644473 TGGCTGCTTTGGAGCTACAAGGG - Intronic
1078124115 11:8542528-8542550 TGGATGTTTTGCAGCATCCTTGG - Intronic
1078501256 11:11879960-11879982 TGTTTGTTTTGGAAGAATCAAGG - Intronic
1078907263 11:15699242-15699264 TGGTTGATGTGGAGCTACAAAGG + Intergenic
1082215720 11:49566146-49566168 TGGTTGTTTAGCAGCACCCCTGG - Intergenic
1085895141 11:80630247-80630269 AGGTTATTTTGGTGTAACCAAGG - Intergenic
1086090975 11:83004516-83004538 TGGTTGTTTTGGATTTATCAGGG - Intronic
1086633861 11:89058330-89058352 TGGTTGTTTAGCAGCACCCCTGG + Intronic
1086876755 11:92105920-92105942 GGGTGGTTTTGGAGTAACCATGG - Intergenic
1087064160 11:94011725-94011747 TGGTAGGTGTGGAGGAACCAAGG + Intergenic
1087278460 11:96183960-96183982 GGTTTGTTTTGGACCAACTATGG + Intronic
1089342240 11:117765950-117765972 TGGCTTTTTTCCAGCAACCACGG + Intronic
1089830316 11:121321642-121321664 AGGTTGCTTTGCAGGAACCAAGG + Intergenic
1091337091 11:134780201-134780223 TGCTGGTTTTGGAGTAATCAGGG + Intergenic
1092476966 12:8827939-8827961 TGTTTGTTTTGGAGAAAGTAAGG - Intronic
1093366128 12:18302092-18302114 TGGTAGTGGTGGACCAACCATGG + Intronic
1095739597 12:45592782-45592804 TGCCTGTTTTGGGGCAAGCATGG - Intergenic
1101577801 12:106014057-106014079 TGGATGTTTTGGGACACCCAAGG - Intergenic
1106521689 13:30503988-30504010 TGGTGTTTTGGGAGCACCCATGG + Intronic
1106780990 13:33058727-33058749 CTGTTGTTTTGGAACAATCACGG + Intronic
1107179181 13:37438220-37438242 TAGTTGTCTTGCAGAAACCAGGG + Intergenic
1107722973 13:43268223-43268245 TGGTTGATTTGGAGCAAATTTGG + Intronic
1108909548 13:55527944-55527966 TGGTTTTTTTGGAGGTAGCAGGG - Intergenic
1112166561 13:96926538-96926560 TGGTAGTTGTGGAGCAAGCATGG - Intergenic
1113673242 13:112189275-112189297 TGGCTGTTTCTGAGCAACCACGG - Intergenic
1113917050 13:113880752-113880774 TGGCAGCTTTGGAGCAAGCAGGG - Intergenic
1115023259 14:28709028-28709050 TGGTTGCTTTTGAGCTACAATGG + Intergenic
1117024118 14:51602381-51602403 TGGATGATTTGGAGCAAGAAAGG + Intronic
1117055098 14:51904171-51904193 TGGCAGTTTTTGAGCACCCAGGG - Intronic
1117795305 14:59387835-59387857 TTGTTGTTTGGGAGAAAGCAAGG - Intergenic
1119260125 14:73233146-73233168 TGGCTGTTTTCAAGCTACCAAGG - Intergenic
1120179070 14:81324833-81324855 TTGTTGGTTTGGAGGAAGCATGG + Intronic
1120295075 14:82629886-82629908 TAGTTGTTTTTGTGAAACCATGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1125059458 15:35401424-35401446 TGGTTATTCTGGAGGAAGCAGGG + Intronic
1128839362 15:70837196-70837218 TTGTTGTTTTGTAGCAACAGGGG - Intronic
1131193096 15:90333053-90333075 GGGTGGTTTTGTAGCATCCAGGG + Intergenic
1131867220 15:96724006-96724028 TGGTTGCTTTCAAGCTACCATGG + Intergenic
1133474595 16:6107917-6107939 TGATTTTTTTGGAGGAAACATGG - Intronic
1133617085 16:7487239-7487261 TGGATGTCTTGGAGGAAACAAGG - Intronic
1135815238 16:25626670-25626692 TGGCTGCTTTTGAGCAACAAGGG - Intergenic
1139979970 16:70848978-70849000 TGATTGTTTTTGAGCAAGCCTGG + Intronic
1140991353 16:80215176-80215198 TAGTTGATTTGGAGAAACTAAGG - Intergenic
1141972802 16:87494255-87494277 TGTTTGTTTTGGAGCGACTGGGG - Intergenic
1142963643 17:3567010-3567032 TGTTTGTTTTGTTGCATCCAAGG - Intronic
1143517027 17:7424974-7424996 TGGTTAGGTTGGAGAAACCATGG + Intergenic
1147003627 17:37383839-37383861 TGGTTGTTTTGGACCAAGTGAGG - Intronic
1147888821 17:43702788-43702810 TGGTTGATTTGGAGTACGCAAGG - Intergenic
1148775183 17:50091239-50091261 TGGTGGTTGTGGGGAAACCAAGG - Intergenic
1148964347 17:51422258-51422280 TCCTTGTTTTGGGGCAACCCAGG + Intergenic
1150698416 17:67425912-67425934 TGGTTGCTTTTGAGCTACAATGG - Intronic
1150819229 17:68421711-68421733 AGGTGGTTTTGGAGAAAACAAGG - Exonic
1153606264 18:6836415-6836437 TGGTGGGTTTAGAGCAAGCAGGG + Intronic
1159598516 18:70406450-70406472 AGGATGGTATGGAGCAACCATGG - Intergenic
1160507066 18:79433077-79433099 TGTTTGTCTTGCAGCAATCATGG + Intronic
1161665252 19:5572018-5572040 TTTTTGTTTTTGAGCAAACAGGG + Intergenic
1163245231 19:16089435-16089457 TGGTATTTCTGGAGGAACCAGGG - Intronic
926236489 2:11049170-11049192 TGGTGGTTTTAGATCAACCTTGG + Intergenic
927053246 2:19349825-19349847 TGGTTGTTTTGGAGCAACCATGG + Intergenic
927244460 2:20945871-20945893 TGGTGGGTTTTGAGCAGCCAGGG - Intergenic
928223853 2:29430486-29430508 TGGTTGTTTTTATGCTACCATGG - Intronic
929978173 2:46654808-46654830 TGGTCTTTTTGTAGCAGCCATGG - Intergenic
932396118 2:71449566-71449588 TTGTTGTTTTTAAGCCACCATGG - Intergenic
933317133 2:80728182-80728204 TGTTTGTTTGGGAGAAACTAAGG + Intergenic
933791185 2:85885236-85885258 TGGTTTGTTTGCAGCAACAAGGG + Intronic
941848979 2:170159954-170159976 TGGATGTTTTGGCACAACCCTGG - Intergenic
944001244 2:194841107-194841129 TGGTTTATCTGGTGCAACCAGGG - Intergenic
945474583 2:210265906-210265928 TGGGTGTGTTGGTGAAACCAAGG + Intergenic
1171294705 20:24007110-24007132 TGGTTGTTTTGCAGCAAACCTGG - Intergenic
1172164484 20:32890688-32890710 TGGCTGTTCTGGAACAAGCAGGG + Intronic
1173869174 20:46330932-46330954 TGGTTCATTTGGAGCAGACATGG - Intergenic
1174023934 20:47556273-47556295 AGGTTGTTTTGGAACAAGAAGGG + Intronic
1177892727 21:26826067-26826089 TGGTTTTTTTGAAGAAAACATGG + Intergenic
1178363589 21:31969943-31969965 TGGCTGTTTTTGAGCAAACAAGG + Intronic
1180563281 22:16639601-16639623 TGTTTGTTTGGGAGAAAGCAAGG + Intergenic
1181264629 22:21623806-21623828 TTTTGGTTTTGGAGCAGCCAGGG - Exonic
952586217 3:34895673-34895695 TTGTTGTTTTGGAGGTACAATGG + Intergenic
953901682 3:46847139-46847161 TGGGTGCTTCGGAGCATCCAAGG + Intergenic
954593358 3:51803198-51803220 TGGTTGTTTTTGAGCTACAATGG + Intergenic
958639390 3:96785311-96785333 TGGTTGTTTTGGAGACTCAATGG - Intergenic
959063162 3:101633889-101633911 TGGCTATTTTGGATCCACCACGG - Intergenic
959885045 3:111489227-111489249 TGGGTGTTTTCCAGGAACCAAGG - Intronic
960525913 3:118709454-118709476 GAGTTGTTTTTGAGCAACCAAGG - Intergenic
960870152 3:122239731-122239753 TGTTTGTTTTGGAGGAAGTAAGG + Intronic
962219111 3:133548598-133548620 AGGTTGTTTTGGAGCATCGAAGG - Intergenic
962808253 3:138941761-138941783 GGGTTGGTTTGGAGAAAGCAGGG - Intergenic
965328516 3:167339147-167339169 TTATTGTTTTGAAGCAATCAGGG + Intronic
969944330 4:10767585-10767607 TAGTTGTTTTGGAGAACCAAGGG + Intergenic
972909657 4:43798247-43798269 TGGTTGTTTGGGAGAATCTAAGG + Intergenic
977240258 4:94560049-94560071 TGGTGGTTTAGAAGCATCCAAGG + Intronic
979213170 4:118131887-118131909 TGTTTGTTTGGGAGAAACTAAGG - Intronic
982036069 4:151347187-151347209 TGGTAGGTTTGGTGCACCCATGG + Intergenic
984425796 4:179583729-179583751 TGGTTGCTTTTGTGCTACCATGG - Intergenic
986553146 5:8981338-8981360 TGGTGGGTTTAGAGCAAACAGGG - Intergenic
986858268 5:11897687-11897709 TGGTTGATTTGTAGCAACTATGG - Intronic
990764602 5:59168351-59168373 GGGGTGTTTCGGAGGAACCAGGG - Intronic
991630872 5:68655327-68655349 TGGGTGTTTGGGATGAACCAGGG + Intergenic
994626975 5:102232371-102232393 TGGTTGCTTTGGTGCCAGCAGGG + Intergenic
995189093 5:109301906-109301928 TGGGTGTTTTTGATCAACCTGGG + Intergenic
996554325 5:124762462-124762484 TGGTTTTTTTGGAGAAGTCATGG + Intergenic
997832784 5:137165233-137165255 TGTTTGTTTGGGAGAAAGCAAGG + Intronic
1007123173 6:39400476-39400498 TGTTTGTTTTGGAGCCCACAAGG - Intronic
1007200127 6:40100386-40100408 TGATTGTTTTAGAACAAGCATGG + Intergenic
1007411017 6:41661595-41661617 TGGTTGGCTTAGAGCAATCATGG - Intergenic
1007987687 6:46223655-46223677 TGCTAGTTTTTGAGCAACCTTGG + Intronic
1010108973 6:72202316-72202338 TGGTTCCTTTGGAGGAACCTGGG + Intronic
1010744407 6:79544475-79544497 TGGTTGATTTTGAGCTACCAGGG - Intergenic
1012224619 6:96689471-96689493 TGTTTGTTTTGGAGAAAGTAAGG + Intergenic
1014147110 6:118011035-118011057 TGGATGTTTTGCAGCACCCCTGG - Intronic
1017820585 6:158046247-158046269 AGCTTGTTTTGAAGAAACCATGG - Intronic
1017837562 6:158192846-158192868 TGGTGTTTTTGTAGCAACCTCGG - Exonic
1018398758 6:163401875-163401897 TGTTTGTTTTGGAGGCAGCAGGG + Intergenic
1019037665 6:169075191-169075213 GCGTTGTTTTGGAGGAGCCATGG + Intergenic
1019898767 7:4003249-4003271 TGGTTGGTCTGGAGCAGGCAGGG - Intronic
1024795727 7:53017329-53017351 TGGTTGCTTTTGTGCAACAAAGG + Intergenic
1027436779 7:78172945-78172967 TGGTTGTTTTGGAGAGACTTAGG + Intronic
1027494648 7:78872089-78872111 TGTTTGTTTTGGAGGAAAGAAGG - Intronic
1028855298 7:95585541-95585563 CGTTTGTTTTGGAGGAAACAAGG + Exonic
1030370379 7:108693484-108693506 TGTATGTTTTGGAGAAAGCAAGG - Intergenic
1033762924 7:144456131-144456153 TGGTTGTCTTTGAGCAACTACGG - Intronic
1034092784 7:148379493-148379515 TAGTTGTTTGGGACCAACCTGGG + Intronic
1034539682 7:151748994-151749016 TGGGTGTTTTGGAGCCTCCGAGG + Intronic
1038522843 8:28248046-28248068 TTGTTGTCTTGCAGCAGCCAAGG - Intergenic
1039701264 8:39964153-39964175 TGGATGTTTTGTAGAACCCATGG - Intronic
1043925790 8:86035439-86035461 TGGTTCTTTTGGAAGAACAATGG - Intronic
1045363893 8:101457797-101457819 TGGTTGTTTAAGAACAACCGAGG + Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1048938551 8:139377099-139377121 TGGTTGGTTTTAAGCAAACATGG - Intergenic
1050271043 9:3945565-3945587 TGGAGGTATTGGAGCAAGCAGGG - Intronic
1050592019 9:7170784-7170806 TGGTTATTTTGGAAAAACCAAGG + Intergenic
1051047298 9:12889669-12889691 TGTTTGTTTGGGAGCAAGTAAGG + Intergenic
1056834859 9:89946011-89946033 TGTTTGTTTTGCAGAAAACAAGG - Intergenic
1057647685 9:96892055-96892077 TGGTGGTTGTGGGGCAATCAGGG + Intergenic
1058559563 9:106211762-106211784 TTGTTGTTTTGGAGCCATCTAGG + Intergenic
1186463617 X:9767366-9767388 GGGTTTTTTTCAAGCAACCAAGG + Intronic
1186754843 X:12659508-12659530 AGGATGTTTTGCAGCAACTATGG + Intronic
1187071495 X:15892940-15892962 TGGTTGTTATGCAGCACCAAGGG + Intergenic
1187575909 X:20555106-20555128 TGGCTGTTTTCAGGCAACCATGG + Intergenic
1188432887 X:30126552-30126574 AGGATGTATTGGTGCAACCAAGG - Intergenic
1190190399 X:48272238-48272260 TGGTTGTATAGCAGCAGCCAAGG + Intronic
1190659132 X:52638728-52638750 TGGTTGTATAGCAGCAGCCAAGG + Intergenic
1191703860 X:64071664-64071686 TGTTTGTTTTGGAGGAAGTAAGG + Intergenic
1194804289 X:98308245-98308267 TGGCTGATTTTGAGCTACCATGG + Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1199405253 X:147450321-147450343 TGGTTATTTTGGAAGAATCATGG - Intergenic
1200395155 X:155981683-155981705 TGGTTTTTTTGCAGCAAAAATGG + Intergenic