ID: 927055512

View in Genome Browser
Species Human (GRCh38)
Location 2:19362275-19362297
Sequence TAGTTCCTCTGGAACCATTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927055508_927055512 16 Left 927055508 2:19362236-19362258 CCTCTGTATTCATTTAGATGATG No data
Right 927055512 2:19362275-19362297 TAGTTCCTCTGGAACCATTACGG No data
927055507_927055512 17 Left 927055507 2:19362235-19362257 CCCTCTGTATTCATTTAGATGAT No data
Right 927055512 2:19362275-19362297 TAGTTCCTCTGGAACCATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927055512 Original CRISPR TAGTTCCTCTGGAACCATTA CGG Intergenic
No off target data available for this crispr