ID: 927056189

View in Genome Browser
Species Human (GRCh38)
Location 2:19367596-19367618
Sequence GAGGGGAGTGACCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927056189_927056197 2 Left 927056189 2:19367596-19367618 CCTTCCACATGGTCACTCCCCTC No data
Right 927056197 2:19367621-19367643 CTGGCACCAGAGCAGGAGCCTGG No data
927056189_927056194 -5 Left 927056189 2:19367596-19367618 CCTTCCACATGGTCACTCCCCTC No data
Right 927056194 2:19367614-19367636 CCCTCTCCTGGCACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927056189 Original CRISPR GAGGGGAGTGACCATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr