ID: 927056429

View in Genome Browser
Species Human (GRCh38)
Location 2:19369702-19369724
Sequence CTGGGCCAAGTGACCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927056429_927056442 25 Left 927056429 2:19369702-19369724 CCAGCAGAGGTCACTTGGCCCAG No data
Right 927056442 2:19369750-19369772 GCCCCTCCATCCAGGATCATGGG No data
927056429_927056441 24 Left 927056429 2:19369702-19369724 CCAGCAGAGGTCACTTGGCCCAG No data
Right 927056441 2:19369749-19369771 TGCCCCTCCATCCAGGATCATGG No data
927056429_927056439 17 Left 927056429 2:19369702-19369724 CCAGCAGAGGTCACTTGGCCCAG No data
Right 927056439 2:19369742-19369764 CAGCCATTGCCCCTCCATCCAGG No data
927056429_927056433 -8 Left 927056429 2:19369702-19369724 CCAGCAGAGGTCACTTGGCCCAG No data
Right 927056433 2:19369717-19369739 TGGCCCAGGGCCTCCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927056429 Original CRISPR CTGGGCCAAGTGACCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr