ID: 927066971

View in Genome Browser
Species Human (GRCh38)
Location 2:19481347-19481369
Sequence AGGGTTCAGAAAGGGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927066967_927066971 -6 Left 927066967 2:19481330-19481352 CCTTAAAAGAGGAAAGAAGGGTT No data
Right 927066971 2:19481347-19481369 AGGGTTCAGAAAGGGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927066971 Original CRISPR AGGGTTCAGAAAGGGGTGTT TGG Intergenic
No off target data available for this crispr