ID: 927075607

View in Genome Browser
Species Human (GRCh38)
Location 2:19573996-19574018
Sequence CACTGTGACCACAGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927075599_927075607 18 Left 927075599 2:19573955-19573977 CCTTCTTTGTAAATAGGTGGTAT No data
Right 927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG No data
927075604_927075607 -8 Left 927075604 2:19573981-19574003 CCATCTGGCGGCTCACACTGTGA No data
Right 927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG No data
927075602_927075607 -6 Left 927075602 2:19573979-19574001 CCCCATCTGGCGGCTCACACTGT No data
Right 927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG No data
927075603_927075607 -7 Left 927075603 2:19573980-19574002 CCCATCTGGCGGCTCACACTGTG No data
Right 927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927075607 Original CRISPR CACTGTGACCACAGAGGAGA GGG Intergenic
No off target data available for this crispr