ID: 927076084

View in Genome Browser
Species Human (GRCh38)
Location 2:19579355-19579377
Sequence ATCATGTCTGCAACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927076084_927076088 21 Left 927076084 2:19579355-19579377 CCTTTGAGAGTTGCAGACATGAT No data
Right 927076088 2:19579399-19579421 TCTGTATATTTCCTAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927076084 Original CRISPR ATCATGTCTGCAACTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr