ID: 927078210

View in Genome Browser
Species Human (GRCh38)
Location 2:19601449-19601471
Sequence TTTCTCATGATGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927078205_927078210 -4 Left 927078205 2:19601430-19601452 CCCATCTCCAGCCTTGATCTTTC No data
Right 927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG No data
927078206_927078210 -5 Left 927078206 2:19601431-19601453 CCATCTCCAGCCTTGATCTTTCT No data
Right 927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927078210 Original CRISPR TTTCTCATGATGAATGTGGA TGG Intergenic
No off target data available for this crispr