ID: 927078943

View in Genome Browser
Species Human (GRCh38)
Location 2:19608976-19608998
Sequence ATTGTTATGAGAGGTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927078943_927078950 11 Left 927078943 2:19608976-19608998 CCCAATACACCTCTCATAACAAT No data
Right 927078950 2:19609010-19609032 GTGTGGTCCAAAATAAATTGAGG No data
927078943_927078946 -6 Left 927078943 2:19608976-19608998 CCCAATACACCTCTCATAACAAT No data
Right 927078946 2:19608993-19609015 AACAATTCCATCCCAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927078943 Original CRISPR ATTGTTATGAGAGGTGTATT GGG (reversed) Intergenic
No off target data available for this crispr