ID: 927089623

View in Genome Browser
Species Human (GRCh38)
Location 2:19700647-19700669
Sequence TCTGCTGGGTGGTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927089623_927089637 21 Left 927089623 2:19700647-19700669 CCACCAGGCCACCACCCAGCAGA No data
Right 927089637 2:19700691-19700713 TTACTACCCTTGGTCACCCAAGG No data
927089623_927089638 22 Left 927089623 2:19700647-19700669 CCACCAGGCCACCACCCAGCAGA No data
Right 927089638 2:19700692-19700714 TACTACCCTTGGTCACCCAAGGG No data
927089623_927089636 11 Left 927089623 2:19700647-19700669 CCACCAGGCCACCACCCAGCAGA No data
Right 927089636 2:19700681-19700703 CAGAGGTTATTTACTACCCTTGG No data
927089623_927089631 -6 Left 927089623 2:19700647-19700669 CCACCAGGCCACCACCCAGCAGA No data
Right 927089631 2:19700664-19700686 AGCAGAAGGGCAGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927089623 Original CRISPR TCTGCTGGGTGGTGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr