ID: 927089839

View in Genome Browser
Species Human (GRCh38)
Location 2:19701933-19701955
Sequence AACCAAGGAGTCCCCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927089836_927089839 -8 Left 927089836 2:19701918-19701940 CCAGAGAAAGTGTCAAACCAAGG No data
Right 927089839 2:19701933-19701955 AACCAAGGAGTCCCCCCAGGTGG No data
927089835_927089839 7 Left 927089835 2:19701903-19701925 CCAGGAGCACAGCTGCCAGAGAA No data
Right 927089839 2:19701933-19701955 AACCAAGGAGTCCCCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927089839 Original CRISPR AACCAAGGAGTCCCCCCAGG TGG Intergenic
No off target data available for this crispr