ID: 927096667

View in Genome Browser
Species Human (GRCh38)
Location 2:19752454-19752476
Sequence GGAAAGCAGGACATGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927096667_927096675 6 Left 927096667 2:19752454-19752476 CCTACACCCATGTCCTGCTTTCC No data
Right 927096675 2:19752483-19752505 GCAGTAAATACTTTGAGAGCAGG No data
927096667_927096677 25 Left 927096667 2:19752454-19752476 CCTACACCCATGTCCTGCTTTCC No data
Right 927096677 2:19752502-19752524 CAGGGACCACATCTCATTCATGG No data
927096667_927096676 7 Left 927096667 2:19752454-19752476 CCTACACCCATGTCCTGCTTTCC No data
Right 927096676 2:19752484-19752506 CAGTAAATACTTTGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927096667 Original CRISPR GGAAAGCAGGACATGGGTGT AGG (reversed) Intergenic
No off target data available for this crispr