ID: 927099390

View in Genome Browser
Species Human (GRCh38)
Location 2:19776332-19776354
Sequence CCTAATGTGCAGCTTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927099390_927099393 -2 Left 927099390 2:19776332-19776354 CCAAGTACAAGCTGCACATTAGG No data
Right 927099393 2:19776353-19776375 GGGACAAAACCACATCCCCAAGG No data
927099390_927099398 18 Left 927099390 2:19776332-19776354 CCAAGTACAAGCTGCACATTAGG No data
Right 927099398 2:19776373-19776395 AGGCTGAGCTTGAAGATCACAGG No data
927099390_927099399 30 Left 927099390 2:19776332-19776354 CCAAGTACAAGCTGCACATTAGG No data
Right 927099399 2:19776385-19776407 AAGATCACAGGCCATTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927099390 Original CRISPR CCTAATGTGCAGCTTGTACT TGG (reversed) Intergenic
No off target data available for this crispr