ID: 927100906

View in Genome Browser
Species Human (GRCh38)
Location 2:19787130-19787152
Sequence CCGAATCACAAGCAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927100896_927100906 30 Left 927100896 2:19787077-19787099 CCTGGATGGTTAAGGGAGCACTC No data
Right 927100906 2:19787130-19787152 CCGAATCACAAGCAGGAGAGAGG No data
927100903_927100906 -2 Left 927100903 2:19787109-19787131 CCTTGGGATCTGGTTAAGGGGCC No data
Right 927100906 2:19787130-19787152 CCGAATCACAAGCAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927100906 Original CRISPR CCGAATCACAAGCAGGAGAG AGG Intergenic
No off target data available for this crispr