ID: 927101606

View in Genome Browser
Species Human (GRCh38)
Location 2:19791777-19791799
Sequence AGGGTGTCCCAAAACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927101606_927101610 11 Left 927101606 2:19791777-19791799 CCTTGAGAGTTTTGGGACACCCT No data
Right 927101610 2:19791811-19791833 TTGTAGCACACCCCTCAGTTTGG No data
927101606_927101611 12 Left 927101606 2:19791777-19791799 CCTTGAGAGTTTTGGGACACCCT No data
Right 927101611 2:19791812-19791834 TGTAGCACACCCCTCAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927101606 Original CRISPR AGGGTGTCCCAAAACTCTCA AGG (reversed) Intergenic
No off target data available for this crispr