ID: 927105418

View in Genome Browser
Species Human (GRCh38)
Location 2:19819513-19819535
Sequence GTCCTCAGTGAGCTCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927105418_927105425 19 Left 927105418 2:19819513-19819535 CCTCCCTCGAGCTCACTGAGGAC No data
Right 927105425 2:19819555-19819577 AGCTGGCTTCATTGCCATTGTGG No data
927105418_927105422 -7 Left 927105418 2:19819513-19819535 CCTCCCTCGAGCTCACTGAGGAC No data
Right 927105422 2:19819529-19819551 TGAGGACACTGTGGCTGCCTAGG No data
927105418_927105423 2 Left 927105418 2:19819513-19819535 CCTCCCTCGAGCTCACTGAGGAC No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927105418 Original CRISPR GTCCTCAGTGAGCTCGAGGG AGG (reversed) Intergenic