ID: 927105423

View in Genome Browser
Species Human (GRCh38)
Location 2:19819538-19819560
Sequence TGTGGCTGCCTAGGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927105415_927105423 16 Left 927105415 2:19819499-19819521 CCCTGGCTGATGTTCCTCCCTCG No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105418_927105423 2 Left 927105418 2:19819513-19819535 CCTCCCTCGAGCTCACTGAGGAC No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105414_927105423 20 Left 927105414 2:19819495-19819517 CCAGCCCTGGCTGATGTTCCTCC No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105420_927105423 -2 Left 927105420 2:19819517-19819539 CCTCGAGCTCACTGAGGACACTG No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105413_927105423 26 Left 927105413 2:19819489-19819511 CCTCATCCAGCCCTGGCTGATGT No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105419_927105423 -1 Left 927105419 2:19819516-19819538 CCCTCGAGCTCACTGAGGACACT No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data
927105416_927105423 15 Left 927105416 2:19819500-19819522 CCTGGCTGATGTTCCTCCCTCGA No data
Right 927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927105423 Original CRISPR TGTGGCTGCCTAGGCACAGC TGG Intergenic