ID: 927105425

View in Genome Browser
Species Human (GRCh38)
Location 2:19819555-19819577
Sequence AGCTGGCTTCATTGCCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927105419_927105425 16 Left 927105419 2:19819516-19819538 CCCTCGAGCTCACTGAGGACACT No data
Right 927105425 2:19819555-19819577 AGCTGGCTTCATTGCCATTGTGG No data
927105420_927105425 15 Left 927105420 2:19819517-19819539 CCTCGAGCTCACTGAGGACACTG No data
Right 927105425 2:19819555-19819577 AGCTGGCTTCATTGCCATTGTGG No data
927105418_927105425 19 Left 927105418 2:19819513-19819535 CCTCCCTCGAGCTCACTGAGGAC No data
Right 927105425 2:19819555-19819577 AGCTGGCTTCATTGCCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927105425 Original CRISPR AGCTGGCTTCATTGCCATTG TGG Intergenic