ID: 927112989

View in Genome Browser
Species Human (GRCh38)
Location 2:19877580-19877602
Sequence CCTCAGCCTCCTGAATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 833888
Summary {0: 4324, 1: 106582, 2: 211547, 3: 247830, 4: 263605}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927112989_927112995 3 Left 927112989 2:19877580-19877602 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG No data
927112989_927112996 6 Left 927112989 2:19877580-19877602 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 927112996 2:19877609-19877631 AGCCTCTTGAACCCTGGAGGTGG No data
927112989_927112994 0 Left 927112989 2:19877580-19877602 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 927112994 2:19877603-19877625 CGGGAGAGCCTCTTGAACCCTGG No data
927112989_927112998 9 Left 927112989 2:19877580-19877602 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 927112998 2:19877612-19877634 CTCTTGAACCCTGGAGGTGGAGG 0: 28
1: 1936
2: 26808
3: 83562
4: 146747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927112989 Original CRISPR CCTCAGCCTCCTGAATAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr