ID: 927112991

View in Genome Browser
Species Human (GRCh38)
Location 2:19877581-19877603
Sequence GCCTCAGCCTCCTGAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 761282
Summary {0: 3459, 1: 93532, 2: 199322, 3: 235334, 4: 229635}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927112991_927112996 5 Left 927112991 2:19877581-19877603 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 927112996 2:19877609-19877631 AGCCTCTTGAACCCTGGAGGTGG No data
927112991_927112995 2 Left 927112991 2:19877581-19877603 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG No data
927112991_927112994 -1 Left 927112991 2:19877581-19877603 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 927112994 2:19877603-19877625 CGGGAGAGCCTCTTGAACCCTGG No data
927112991_927112998 8 Left 927112991 2:19877581-19877603 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 927112998 2:19877612-19877634 CTCTTGAACCCTGGAGGTGGAGG 0: 28
1: 1936
2: 26808
3: 83562
4: 146747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927112991 Original CRISPR GCCTCAGCCTCCTGAATAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr