ID: 927112995

View in Genome Browser
Species Human (GRCh38)
Location 2:19877606-19877628
Sequence GAGAGCCTCTTGAACCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927112989_927112995 3 Left 927112989 2:19877580-19877602 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG No data
927112991_927112995 2 Left 927112991 2:19877581-19877603 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927112995 Original CRISPR GAGAGCCTCTTGAACCCTGG AGG Intergenic
No off target data available for this crispr