ID: 927114742

View in Genome Browser
Species Human (GRCh38)
Location 2:19888966-19888988
Sequence GTGTGGAGGCAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927114742_927114753 24 Left 927114742 2:19888966-19888988 CCTTGCTCCATCTGCCTCCACAC No data
Right 927114753 2:19889013-19889035 TGCAGTTCCAGTAAGTCTACTGG No data
927114742_927114747 1 Left 927114742 2:19888966-19888988 CCTTGCTCCATCTGCCTCCACAC No data
Right 927114747 2:19888990-19889012 ACCCTCCCCAAGCAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927114742 Original CRISPR GTGTGGAGGCAGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr