ID: 927115870

View in Genome Browser
Species Human (GRCh38)
Location 2:19901643-19901665
Sequence GAGGCGACGTTGGGGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927115870_927115887 24 Left 927115870 2:19901643-19901665 CCAAACAACCCCAACGTCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 927115887 2:19901690-19901712 GTCTCGCGATAGTTACCTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
927115870_927115877 -5 Left 927115870 2:19901643-19901665 CCAAACAACCCCAACGTCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 927115877 2:19901661-19901683 GCCTCCACCCGGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 131
927115870_927115888 25 Left 927115870 2:19901643-19901665 CCAAACAACCCCAACGTCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 927115888 2:19901691-19901713 TCTCGCGATAGTTACCTCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 25
927115870_927115881 2 Left 927115870 2:19901643-19901665 CCAAACAACCCCAACGTCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 927115881 2:19901668-19901690 CCCGGGGTCGCCGCGGCCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927115870 Original CRISPR GAGGCGACGTTGGGGTTGTT TGG (reversed) Intronic
922567132 1:226608138-226608160 GAGGCCAAGCTGGGGTTGTGGGG - Exonic
1062982302 10:1735986-1736008 GAGGCAACGTTAGGTGTGTTTGG - Intronic
1063144221 10:3282069-3282091 GAGGCGATATTGGAGTTATTTGG - Intergenic
1075687238 10:124372764-124372786 GATGCCAGGTTGGGGGTGTTGGG + Intergenic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1080403198 11:31955930-31955952 GGGGCGGCGTTGGGTTTGTGGGG + Intronic
1083685723 11:64373764-64373786 TAGGGGAGGTTGGGGCTGTTAGG - Intergenic
1084646739 11:70463461-70463483 GAGGTGGCGCGGGGGTTGTTGGG + Intergenic
1088673444 11:112167239-112167261 GAGGCTACGGTGGGGAAGTTGGG + Intronic
1102960083 12:117086835-117086857 CAGGAGACGCTGGGGTTGCTGGG + Intronic
1102993186 12:117329380-117329402 GAGGACACTTTGGGGTTCTTGGG + Intronic
1103276734 12:119718226-119718248 GAGGGTACGTTGGAGTTGTATGG - Exonic
1114007693 14:18332542-18332564 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1117224285 14:53638753-53638775 GAGGAGAGCTTGGGGTTGGTTGG + Intergenic
1118693529 14:68362454-68362476 GAGGCGAAGTTGGGGAGCTTGGG + Intronic
1128487714 15:68111293-68111315 AAGGCGAAGTTGGGTGTGTTAGG + Intronic
1128904083 15:71451953-71451975 GAGGCGACTCTTGGTTTGTTTGG + Intronic
1132292203 15:100711619-100711641 GAGGGAAGGCTGGGGTTGTTGGG + Intergenic
1137785133 16:51132216-51132238 CAGGCCACATTGGGGTTGGTGGG + Intergenic
1141720322 16:85751958-85751980 GTGGAGACGTTGGGCTTGTAGGG - Intergenic
1142885235 17:2908517-2908539 GAGGGGCCGGTGGGGTTGTTTGG + Intronic
1143448978 17:7024446-7024468 GAGGGGCCGTTGGGGGTGTTGGG - Exonic
1146032231 17:29376158-29376180 GAGGGAAGGCTGGGGTTGTTTGG + Intergenic
1151162491 17:72176969-72176991 GACGCGGCCTTGGGGTTGATGGG - Intergenic
1154006323 18:10530592-10530614 GAGGTGAGGTTGTGTTTGTTAGG + Intronic
1154529768 18:15331421-15331443 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1157583404 18:48786490-48786512 GGGGTGACGTTAGAGTTGTTAGG + Intronic
1160326819 18:77957693-77957715 GCGGTGGTGTTGGGGTTGTTGGG - Intergenic
1160845127 19:1162904-1162926 GAGGGGACGTTGGGGCTGCAGGG + Intronic
1160891847 19:1383187-1383209 GAGGAGGCTTTGGGGTTGTGAGG + Intergenic
1163721067 19:18898551-18898573 GAGGAGACCTTGGGGTGGGTGGG - Intergenic
1165812014 19:38617520-38617542 GAGGCGAAGGTGGGGATGTGGGG + Intronic
927115870 2:19901643-19901665 GAGGCGACGTTGGGGTTGTTTGG - Intronic
930625576 2:53693732-53693754 GAGGAAAAGATGGGGTTGTTAGG - Intronic
938528862 2:132162861-132162883 GAGGGGAGTTTGGGGTTGCTTGG + Intronic
947708032 2:232292458-232292480 CAGGCCCTGTTGGGGTTGTTGGG - Intronic
1174135547 20:48376337-48376359 GAGGACAGGTTGGGGTTGTGGGG + Intergenic
1176767644 21:13037051-13037073 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1176957587 21:15124089-15124111 GAGGCCACTTTGGGGTGGTTTGG - Intergenic
1180432200 22:15263352-15263374 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1183465982 22:37980647-37980669 GAGGCGAAGTTGGGGGTTTGGGG - Intronic
952576239 3:34777350-34777372 GAGCTGAAGTTGGGGATGTTAGG - Intergenic
962511914 3:136110134-136110156 GAAGGGGCGGTGGGGTTGTTGGG - Intronic
968949608 4:3683730-3683752 GAGGCGCCGCTGGGGCTGTTGGG - Intergenic
969580135 4:8059930-8059952 GAGGCAGCTTTGGGGTTTTTTGG - Intronic
997519388 5:134512811-134512833 GAGTCGACCTTGGGGTTACTGGG - Intergenic
1005486421 6:26304744-26304766 GCGGGGAGGTTGGGGTTGTGGGG + Intergenic
1022040857 7:26579957-26579979 GAGGTGACGTTGGTGTGGCTGGG + Intergenic
1030592487 7:111499400-111499422 GAGGAGACCTTGGGGCTCTTAGG - Intronic
1031074576 7:117200260-117200282 GAGGGGGCCTTGGGGTTGCTGGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1039855839 8:41413165-41413187 GCGGTGACATTGGGTTTGTTGGG - Intergenic
1041480861 8:58318420-58318442 GAAGGGAGGTTGGGGTTGGTGGG + Intergenic
1043840533 8:85098441-85098463 GTGGTGAAGTTGGGGTTTTTAGG - Intergenic
1048384837 8:133902267-133902289 GAAGCCAAGTTGGGGTTGTCAGG - Intergenic
1049324892 8:142016736-142016758 GAGGGGACGTTGGTGATGTTGGG + Intergenic
1049379336 8:142304265-142304287 AAGGAGGCGTTGGGGTTGCTGGG - Intronic
1053707477 9:40769190-40769212 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1054417389 9:64889958-64889980 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1055368600 9:75572870-75572892 GAGGCAACATTGTGGTTGATGGG + Intergenic
1055595382 9:77860467-77860489 GAGGCGGCGGGGGGATTGTTTGG + Intronic
1057044150 9:91871809-91871831 GAGGCCACGTATGGGTTCTTGGG + Intronic
1057277637 9:93684455-93684477 GTGGCATCGCTGGGGTTGTTTGG - Intergenic
1059595921 9:115720659-115720681 GAGGTGCCTCTGGGGTTGTTAGG + Intergenic
1062043788 9:134415985-134416007 GGGGCGGTGTTGGGGTTGTTGGG + Intronic
1062321602 9:135993040-135993062 GAGGGGAAGTTGGGGCTGTGGGG + Intergenic
1062657994 9:137614026-137614048 GAGGCCACGTTGGGTTGCTTGGG - Exonic
1187326362 X:18294608-18294630 GTGGAGATGTAGGGGTTGTTGGG - Intronic