ID: 927116154

View in Genome Browser
Species Human (GRCh38)
Location 2:19903818-19903840
Sequence TGATCTAAGAGGAAAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927116154 Original CRISPR TGATCTAAGAGGAAAATAGC AGG Intergenic
904654685 1:32035566-32035588 TGTTCTAAGTGGAAAATGGAGGG - Intronic
904880376 1:33691919-33691941 TGAGTTAGGAGGAAAAGAGCAGG - Intronic
908137971 1:61152477-61152499 TGATCTAAGCTGAAAATATGTGG + Intronic
909191743 1:72561128-72561150 TTATCAAAGGGGAAAATATCTGG + Intergenic
911232906 1:95379215-95379237 TGATCTCAGAAGAAAATACTGGG + Intergenic
911705995 1:101013775-101013797 TGTTCTAAGAGCAACAAAGCTGG - Exonic
912065236 1:105730918-105730940 GGATCAAACAGGAATATAGCAGG - Intergenic
912378714 1:109234667-109234689 TTAGATAAGTGGAAAATAGCTGG + Intronic
915617540 1:157051026-157051048 AGAACTAAGAGAAAAATTGCTGG - Intergenic
915702939 1:157812859-157812881 TGGTCTATGAGGAAAAGAACAGG + Intronic
915839854 1:159205093-159205115 TGAAGGAAGAGGAAAAAAGCAGG - Intronic
918971709 1:191428265-191428287 AGTTCTCAGAGGAAAGTAGCAGG - Intergenic
921358600 1:214309157-214309179 TGAACTAAGAGGAAAGTAACGGG - Intronic
921449151 1:215282745-215282767 TAATCTAAGAGGAAATCATCAGG - Intergenic
921450407 1:215299035-215299057 ATACCTAAGAGTAAAATAGCAGG + Intergenic
923501868 1:234571714-234571736 TGAGCTGAGAGGAAAAAAACAGG - Intergenic
923639967 1:235746260-235746282 TAATCTAAGAGGAAACTGGTTGG - Intronic
923847082 1:237746513-237746535 TGATGGAAGAAGAAAAGAGCTGG - Intronic
924802162 1:247335449-247335471 TGAGATAAAAGGAAAATTGCAGG + Intergenic
1067999257 10:51312292-51312314 TGATGGAACAGAAAAATAGCTGG + Intronic
1068139616 10:52989151-52989173 TGATGGAAGAGCAAAATAACAGG - Intergenic
1071176446 10:82931895-82931917 CGATGTATGAGGAAAATACCTGG - Intronic
1072536182 10:96365282-96365304 TTACCTTAGAGGAAAATAGAGGG + Exonic
1075932215 10:126308985-126309007 TGATATAAGAGGTGAATAGAAGG - Intronic
1077867713 11:6236494-6236516 GGATATAAGAGGAAAATAAGAGG + Intronic
1078120321 11:8501671-8501693 GGATCTAAGAGTAGAATTGCTGG - Intronic
1078284654 11:9939798-9939820 TGTTCAAAGGGGAAAAAAGCTGG + Intronic
1081568582 11:44275754-44275776 AGCTCTAAGAGGAAAAAGGCAGG - Intronic
1082722742 11:56698352-56698374 TGAACAAAGAGGAAAAGAGTAGG + Intergenic
1085559648 11:77459655-77459677 TGCTGTAAGAGGAAAACAGAGGG + Intronic
1086616508 11:88827625-88827647 TCATCTGAGATCAAAATAGCAGG - Intronic
1087809222 11:102592256-102592278 AGGTCTGAGAGAAAAATAGCTGG + Intronic
1090601069 11:128371875-128371897 TGAACTAACAGAAAAACAGCAGG - Intergenic
1094326882 12:29250245-29250267 AGATCCAGGAGCAAAATAGCTGG + Intronic
1094789864 12:33899869-33899891 TGAGCTAAGAGAAAGATAGGAGG - Intergenic
1101216269 12:102587497-102587519 TGATTTAAAAAGAAAAGAGCCGG + Intergenic
1101281490 12:103261923-103261945 TGAGCTGAAGGGAAAATAGCTGG + Intronic
1101338115 12:103814884-103814906 TGTTCTAAGAGGAAAAGGGGAGG + Intronic
1104544070 12:129695347-129695369 TAATAAAAGAGGAAACTAGCGGG + Intronic
1105242930 13:18623736-18623758 TGACCTCAGAGGAAAATAAGAGG + Intergenic
1105702794 13:22945657-22945679 GGATCTAAGAGTAACAAAGCTGG - Intergenic
1105855435 13:24367461-24367483 GGATCTAAGAGTAACAAAGCTGG - Intergenic
1106138810 13:26993771-26993793 TGGTCTAAGTGGAAAAAAGAAGG - Intergenic
1112347889 13:98607142-98607164 ACATCTAGGAGTAAAATAGCTGG + Intergenic
1114545158 14:23494537-23494559 TGCTGAGAGAGGAAAATAGCTGG + Intronic
1114723314 14:24906777-24906799 TGATGTAGTAGGAAAATATCAGG + Intronic
1115149296 14:30265703-30265725 GGATCTAGGGGGAAAATATCAGG - Intergenic
1115706479 14:36004284-36004306 TTATATAACAGGAATATAGCTGG + Intergenic
1116819304 14:49612387-49612409 TGATCTATTAGGAAAATATGTGG + Intronic
1117775158 14:59176494-59176516 TGATCTAGGAAGGTAATAGCTGG + Intergenic
1118418098 14:65566220-65566242 TGTTCCAAGAGGAAAATAGCAGG + Intronic
1118529163 14:66683117-66683139 TAATCCAAGAGGATAATGGCAGG - Intronic
1119995817 14:79252621-79252643 AGATCTAAGAGGGAATTAACAGG + Intronic
1120599461 14:86483639-86483661 TGACCTAGGAGTAAAATTGCTGG + Intergenic
1121863765 14:97343236-97343258 TGATGTAAGAGCAAAATAAGAGG + Intergenic
1122844428 14:104483902-104483924 GGATCTAAGAGTAAAAAAGCTGG - Intronic
1123488366 15:20760894-20760916 TGACCTCAGAGGAAAATAAGAGG - Intergenic
1123544863 15:21329967-21329989 TGACCTCAGAGGAAAATAAGAGG - Intergenic
1126166798 15:45660304-45660326 TGATTTGAGAGGAAACTAGGGGG + Intronic
1126928922 15:53625356-53625378 TGATTTTTGAGGAAAATACCAGG - Intronic
1128105506 15:65041674-65041696 TAATCTAGGGGGAAATTAGCAGG + Intergenic
1128185171 15:65638572-65638594 AGAACTAAGAGAAAGATAGCAGG + Intronic
1128388329 15:67166025-67166047 TGCTCTAAGAGGAACGCAGCAGG - Intronic
1202953209 15_KI270727v1_random:57238-57260 TGACCTCAGAGGAAAATAAGAGG - Intergenic
1134673793 16:16075269-16075291 TGAAGTAAAAGGAAAATAACAGG + Intronic
1136573391 16:31109592-31109614 GGATCCACGAGGAAAATAGAGGG - Intronic
1137571767 16:49570978-49571000 TGAGCTAACAGGAAAAGAGCAGG + Intronic
1138960212 16:62020193-62020215 TGATTTAAAAGAAAAATAGGAGG - Intronic
1138965702 16:62081512-62081534 TTATCTGAGAGGAAAAGAGAAGG + Intergenic
1142987133 17:3702830-3702852 TGATGTAAAAAGAAAATGGCAGG - Intergenic
1144030123 17:11312530-11312552 TGATCTAGGAGTAAAAAAGGAGG - Intronic
1147501117 17:40964697-40964719 TGATCTTTTAGGAAAATAACAGG - Intronic
1148595048 17:48847390-48847412 TGATTTAAGGGGAAAGTTGCGGG - Intronic
1149421731 17:56518329-56518351 TGCTCTAAGAGAAAAACAACTGG + Intergenic
1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG + Intergenic
1154391206 18:13937825-13937847 TGTCCTAAAAGGAAACTAGCAGG - Intergenic
1154446007 18:14436161-14436183 TGACCTCAGAGGAAAATAAGAGG - Intergenic
1155982779 18:32197995-32198017 TGATCTTTAAGAAAAATAGCAGG - Intronic
1156321323 18:36026584-36026606 AGAAATAATAGGAAAATAGCAGG - Intronic
1156703851 18:39856529-39856551 TGAACCATGAGGAAAATAACTGG + Intergenic
1158725999 18:59972896-59972918 AGATATAAAATGAAAATAGCTGG + Intergenic
1158898637 18:61940105-61940127 TCTTCTACGAGGAAAACAGCAGG + Intergenic
1159227184 18:65554990-65555012 AAATTTCAGAGGAAAATAGCAGG + Intergenic
1159347818 18:67229668-67229690 TTATCAAAGAGAAAAATAACTGG + Intergenic
1164169432 19:22711748-22711770 TGATTGAAAAGGAGAATAGCTGG - Intergenic
1165205641 19:34183033-34183055 TGATATAAGAGTGAAAAAGCAGG - Intronic
926705825 2:15836705-15836727 AGATCTAGGAGTAAAATTGCTGG - Intergenic
927116154 2:19903818-19903840 TGATCTAAGAGGAAAATAGCAGG + Intergenic
928618638 2:33066015-33066037 TGATCTAATAGAAAACTGGCCGG - Intronic
929931109 2:46256228-46256250 TAATATAAGATGTAAATAGCAGG + Intergenic
933746005 2:85571830-85571852 ATATCTCAGAGGAAAAAAGCTGG - Intronic
939790845 2:146573276-146573298 GTACCTAAGTGGAAAATAGCTGG + Intergenic
941298780 2:163774960-163774982 TGATCTAATAGGAAACCAACAGG + Intergenic
942000207 2:171638905-171638927 TGATCTGACTGGATAATAGCTGG - Intergenic
943247772 2:185477381-185477403 TGATCTAACACGAACATGGCTGG - Intergenic
944865586 2:203858158-203858180 TGTTCTAAGAGGAAAATCTCTGG - Intergenic
1169545540 20:6646717-6646739 TGGTCTAGGAGGAAAATAAGGGG + Intergenic
1169902212 20:10565112-10565134 TGAATTAAGAGGAAAATCACAGG - Intronic
1172704376 20:36872341-36872363 TCATCTGAGAGGAAACCAGCAGG + Intergenic
1174829787 20:53802056-53802078 TGGTGTAAGATGAAAATATCTGG - Intergenic
1176449972 21:6853696-6853718 TGACCTCAGAGGAAAATAAGAGG + Intergenic
1176828141 21:13718714-13718736 TGACCTCAGAGGAAAATAAGAGG + Intergenic
1182778835 22:32851281-32851303 AGAGCTGAGAGGGAAATAGCTGG + Intronic
1182881864 22:33740621-33740643 TGATCTAAGAGAAAAAGAAGGGG + Intronic
1183195071 22:36347887-36347909 TGATGCAAGAGGAACAAAGCAGG + Intronic
1183671752 22:39277013-39277035 ATATCTAGGAGGAAAATTGCTGG - Intergenic
949615008 3:5743986-5744008 TTATATAAGAGGAGAATAGAGGG - Intergenic
949833685 3:8244862-8244884 TCATCTAAGAGGAAAAATCCTGG - Intergenic
950167009 3:10808817-10808839 TGATTTAAGTAGAAAATAGATGG - Intergenic
951121002 3:18928654-18928676 AGATCTAACATGCAAATAGCAGG - Intergenic
951659410 3:25046065-25046087 TGATCTAGGACCAAAAGAGCCGG - Intergenic
952043329 3:29286247-29286269 TCAAATAAGAGGAAAATAGAAGG + Intronic
952461927 3:33536541-33536563 TGAACAAGGAGGAAACTAGCAGG + Intronic
954719117 3:52544871-52544893 TGATATTAGAGGAAAACAGTTGG + Intronic
955628187 3:60942992-60943014 TTATTTCAGAGGAAAAAAGCAGG - Intronic
955962148 3:64351582-64351604 TGATAAAATAGGAGAATAGCAGG + Intronic
959560583 3:107775310-107775332 TGCTCTAAGATAAAAATATCAGG + Intronic
960196669 3:114776996-114777018 TGATTTAGGGGGAAAATGGCTGG - Intronic
960433028 3:117593202-117593224 TAATCTGAGGGGAAAATAGCTGG - Intergenic
960665962 3:120109024-120109046 TAATCTAAGAGGAAAATACAGGG - Intergenic
963693144 3:148530504-148530526 TGATACAGGAGAAAAATAGCAGG - Intergenic
963698737 3:148597303-148597325 TGGTCTTACAGGAAAATAGATGG - Intergenic
963836672 3:150064854-150064876 TGGGCAAAGAGGAAAATAGAAGG - Intergenic
965593572 3:170385563-170385585 TCATTTAAAAGAAAAATAGCTGG + Intronic
967081940 3:186057879-186057901 TTAGCTAAAAGGAAAATGGCAGG - Intronic
968671383 4:1853757-1853779 TCATCTAAGATGTTAATAGCAGG + Intronic
970821643 4:20222945-20222967 TAAGCTAAGAGGTAAAAAGCAGG - Intergenic
971260787 4:25054807-25054829 AGATCTAAGAGGAAATTGACAGG + Intergenic
972302297 4:37796302-37796324 GCGTCTAAGAGGAAAATAGACGG - Intergenic
973595567 4:52485536-52485558 TGATGTAAGATGATGATAGCAGG + Intergenic
974394390 4:61315764-61315786 TCATCTAAGACCAAAACAGCAGG - Intronic
975210518 4:71694568-71694590 TTTCCTAAGAGGATAATAGCTGG - Intergenic
979359871 4:119748967-119748989 AGATTTAATAGAAAAATAGCTGG - Intergenic
980199767 4:129641139-129641161 GGATCTAAGTGCAAAATAACAGG - Intergenic
980809968 4:137864754-137864776 TGGCCTAAGAGGAAAATCTCAGG - Intergenic
981197339 4:141937059-141937081 TGCTCTAGCAGGATAATAGCTGG - Intergenic
981416211 4:144496900-144496922 TCATCTAAGATGAAGATAGCTGG - Intergenic
982329413 4:154164536-154164558 TGACCTATGAGGCAAAAAGCAGG + Intergenic
986370232 5:7072952-7072974 TGATCTGAGAGGAAAAACGCTGG - Intergenic
986570390 5:9157863-9157885 TGACATAGGAGGACAATAGCAGG + Intronic
986905333 5:12488519-12488541 TGATTTACCAGGAAAATAGGTGG + Intergenic
988487700 5:31680379-31680401 TGATCAGAGAGGAAATTAGAAGG + Intronic
988606987 5:32687056-32687078 TGATGTAAGAGGAACACAGAAGG - Intergenic
989645280 5:43624449-43624471 TGAAGAAAGAGTAAAATAGCAGG + Intronic
989760632 5:45011881-45011903 TTAGCTAAGAGTAAAATAGAGGG + Intergenic
991350668 5:65717578-65717600 TGAAATAATAAGAAAATAGCTGG - Intronic
992556706 5:77910832-77910854 GCATCTAAGAGAAAAATAACTGG - Intergenic
993153419 5:84190080-84190102 TAATCTAAGAGAAACATAGATGG + Intronic
994443763 5:99844906-99844928 TTATCTAAGAGCAAAATGACAGG - Intergenic
996316054 5:122161914-122161936 TGATCTTAGAAGAACATAGTTGG - Intronic
997493138 5:134296338-134296360 TCTTCAAAGAGGAAAAGAGCAGG + Intronic
997515509 5:134486368-134486390 TTATCTAAGAGCAGAATTGCTGG - Intergenic
999804297 5:155067527-155067549 TGATCCAACTGGAAAATAGGAGG + Intergenic
1000082637 5:157862390-157862412 TGATCCCAGAGGAAGACAGCAGG - Intergenic
1000258792 5:159566104-159566126 AGAGTTAGGAGGAAAATAGCAGG + Intergenic
1000926788 5:167203891-167203913 AGAAAGAAGAGGAAAATAGCAGG + Intergenic
1003252061 6:4437719-4437741 TTACCAAAGAGCAAAATAGCTGG - Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1011335852 6:86259095-86259117 TGGTCTGAGAAGAAAATAACAGG - Intergenic
1013224673 6:108112166-108112188 TGATATAAGAAGAAAATTGAAGG + Intronic
1013555858 6:111256605-111256627 TTATCTAAAAGGAAAATATCTGG - Intergenic
1015442842 6:133268838-133268860 TGAGCTAAGAGGCAAAAAGCTGG + Intronic
1015952900 6:138571999-138572021 TTGTCTAAGAGGGAAACAGCAGG - Exonic
1016818249 6:148323642-148323664 TGCTGTGATAGGAAAATAGCTGG + Intronic
1017585005 6:155910573-155910595 TTATCTCAGAGGGATATAGCAGG + Intergenic
1017668626 6:156747673-156747695 TGATCAAATAGGAAAATAAGAGG - Intergenic
1018938217 6:168288095-168288117 TAATAGTAGAGGAAAATAGCCGG - Intergenic
1022871135 7:34481064-34481086 TGATCTGAAAGGAAAAGCGCAGG - Intergenic
1024806333 7:53145798-53145820 AAATCTAAGAAGAAAACAGCTGG - Intergenic
1025934893 7:66027636-66027658 TTATGTAAGAGAAAAATGGCTGG + Intergenic
1025949433 7:66132055-66132077 TTATGTAAGAGAAAAATGGCTGG - Intronic
1027469191 7:78552477-78552499 TGAGTTAAAAGGAAAATAGTCGG - Intronic
1028133308 7:87202412-87202434 AGAGCTGAGAGGAAAAGAGCTGG + Intronic
1028405990 7:90474561-90474583 TGATCTTAGAGCACTATAGCTGG + Intronic
1028660313 7:93264768-93264790 TGACCTTAGAGGAAGAAAGCAGG - Intronic
1029387713 7:100254674-100254696 TGATTTAAGAAAAAAAGAGCTGG + Intronic
1031165666 7:118224555-118224577 TGATCTAATAGGAAGACTGCAGG + Intronic
1033848056 7:145459430-145459452 TGAGCTAAGTGGTAAATAGATGG - Intergenic
1033918964 7:146363806-146363828 TGATAAAAGAGAAAAACAGCTGG + Intronic
1040097790 8:43464091-43464113 TGGTCTAAGAGAAAAAAATCTGG - Intergenic
1041637025 8:60156109-60156131 AGATCTAAGAGGAGAGGAGCTGG + Intergenic
1042091068 8:65160318-65160340 TGATCTAAGAAGAAAACACCCGG + Intergenic
1045863619 8:106840236-106840258 TGGTCTAAGTGGAAAATACTGGG - Intergenic
1047066998 8:121296037-121296059 TGATTTAATTGGTAAATAGCTGG + Intergenic
1047683258 8:127276923-127276945 TGATCTAACAGGAAAACAGTGGG + Intergenic
1048910383 8:139129219-139129241 TAATCTCAGAGGTAAAAAGCTGG + Intergenic
1052464268 9:28809849-28809871 TGAAATAAGACCAAAATAGCCGG - Intergenic
1054888698 9:70228553-70228575 TAATCTAAGAGAAAAAAAGGAGG + Intergenic
1055261881 9:74446784-74446806 TGGGCTGAGAGGAAAATAGAAGG + Intergenic
1057736012 9:97661207-97661229 TTATATAAGGGGAAAATACCTGG - Intronic
1058564985 9:106273503-106273525 TAATCAAAGATGAAAATAACTGG - Intergenic
1059801666 9:117755710-117755732 GGATCTCAGAGAAAAATAGAAGG - Intergenic
1203519210 Un_GL000213v1:30821-30843 TGACCTCAGAGGAAAATAAGAGG - Intergenic
1185869291 X:3650223-3650245 TGCTATAAGAGAAAAATGGCGGG + Intronic
1186981624 X:14963038-14963060 TGATCTAAGTAGAAAATAAAGGG + Intergenic
1187450016 X:19387837-19387859 TGATGTAAGGGGTAAATAACTGG + Intronic
1192165507 X:68825211-68825233 TCTTCTAGGAGGAAAATAGGAGG + Intergenic
1198863524 X:141096205-141096227 TGGTATAAGATGAAAATAGAAGG + Intergenic
1198899165 X:141491182-141491204 TGGTATAAGATGAAAATAGAAGG - Intergenic
1199880801 X:151973269-151973291 TGGTCAGAGAGGAAAACAGCAGG - Intronic
1200980071 Y:9255613-9255635 TGGTGTAAGATGAAAATAGAAGG + Intergenic