ID: 927118523

View in Genome Browser
Species Human (GRCh38)
Location 2:19928735-19928757
Sequence AACTCACTTATTATGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927118523_927118524 20 Left 927118523 2:19928735-19928757 CCAGGCAGCATAATAAGTGAGTT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 927118524 2:19928778-19928800 ATCATTACAATAACTCTATGAGG 0: 1
1: 5
2: 34
3: 239
4: 1165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927118523 Original CRISPR AACTCACTTATTATGCTGCC TGG (reversed) Intronic
905289925 1:36914214-36914236 ACTCCACTTACTATGCTGCCTGG + Intronic
908244797 1:62219278-62219300 AACTCTCTTCCTATGCTGCCTGG - Intergenic
909930890 1:81498909-81498931 GACACAATTATTATGCTTCCTGG - Intronic
911529266 1:99024424-99024446 AACTCACTTTTTATACTACAAGG - Intergenic
912193154 1:107364705-107364727 AAAGCACTTAGTATGTTGCCTGG - Intronic
912264949 1:108148026-108148048 AGCTCACTCATGTTGCTGCCAGG - Intronic
912684322 1:111750024-111750046 AGGTTATTTATTATGCTGCCTGG + Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916245982 1:162688744-162688766 AACTTAGCTATTATTCTGCCAGG + Intronic
916513653 1:165495763-165495785 AACTCAGTTATTCTCCAGCCTGG - Intergenic
916636641 1:166676936-166676958 AAGTCACTTATCATGCTTACTGG + Intergenic
920867185 1:209762855-209762877 AACTCACTTGGTTTGCTGACTGG - Exonic
923930401 1:238688524-238688546 AAGTCACTTATCATACAGCCTGG + Intergenic
1065814346 10:29470668-29470690 AACCCACTTTTTAGGCTGGCAGG - Intronic
1068200056 10:53772348-53772370 AGCTCACTGCTTATGCTGCTGGG + Intergenic
1068930084 10:62580899-62580921 AACATACTTATTCTGGTGCCTGG - Intronic
1071252099 10:83829354-83829376 AATTTACTTAGCATGCTGCCTGG - Intergenic
1073876599 10:107930366-107930388 AACTCACAGCTTATGTTGCCTGG - Intergenic
1074047953 10:109856416-109856438 AAATCACTTAGCATGCTGTCAGG - Intergenic
1078472063 11:11597139-11597161 ATCTCACTCATTATGGTGCATGG + Intronic
1079422623 11:20308218-20308240 AAAGCACTTAGAATGCTGCCTGG - Intergenic
1080300449 11:30778772-30778794 AGCTCACATATTATGCTCTCAGG + Intergenic
1081060845 11:38474415-38474437 AACTGACTTGTTTTGCAGCCAGG - Intergenic
1082770305 11:57202669-57202691 AACACACTTAATATGTTGTCTGG - Intergenic
1085564265 11:77499190-77499212 AATTCACTTATAATCCTACCAGG + Intergenic
1085723275 11:78932059-78932081 AAAGCACTTAATAGGCTGCCTGG + Intronic
1086824064 11:91473716-91473738 AACTCACTTATTAAGTTTACAGG - Intergenic
1088729408 11:112667666-112667688 AAAGCACTTAGTATGGTGCCTGG - Intergenic
1091162672 11:133439228-133439250 AACTCAATTGTGACGCTGCCTGG - Intronic
1092986698 12:13852596-13852618 AAGTCACTCATTACTCTGCCAGG - Intronic
1094482579 12:30896463-30896485 AACTCAGTTATTATCTAGCCTGG - Intergenic
1094749307 12:33387080-33387102 AACTCGCTGATTATGCACCCAGG + Intronic
1096457048 12:51796157-51796179 AAAGCACTTATTATGGTACCTGG - Intronic
1097296620 12:57971840-57971862 AATCCATTTATTATGCTGCTGGG - Intergenic
1099870327 12:88340226-88340248 AAATCACTTAGTAGCCTGCCTGG + Intergenic
1107081559 13:36380261-36380283 AGCTCATATATTCTGCTGCCTGG + Intergenic
1108582047 13:51836137-51836159 AACTCATTTACTCTGCTCCCAGG - Intergenic
1109019567 13:57070848-57070870 AACTCACTTACCAAGCTGCAGGG - Intergenic
1109291874 13:60486233-60486255 AACACACTTTTTATTCTGGCAGG + Intronic
1112607207 13:100918570-100918592 AACTCACTTCTGCTGCTGACAGG + Intergenic
1112631124 13:101162291-101162313 AACTTACTTATTATTGTACCTGG + Intronic
1114362014 14:21984250-21984272 AACTCACTAATGAAGCTGTCAGG + Intergenic
1115484790 14:33900315-33900337 AAAACACTTATTATGGTGCCTGG + Intergenic
1116241862 14:42353499-42353521 CACTCACTTATTATTCTGTGAGG - Intergenic
1116470299 14:45278944-45278966 AAATCACTTAATTTGCTTCCAGG + Intergenic
1118068239 14:62215970-62215992 ATCTCAGGTATTATGCTGCTGGG - Intergenic
1118533199 14:66729946-66729968 AACTCATTTAATATTCTTCCAGG + Intronic
1118794892 14:69133305-69133327 GACTCATTTACTTTGCTGCCTGG - Intronic
1119842254 14:77801988-77802010 AACTCACTAAATATGCCTCCTGG + Intronic
1123390156 15:19862959-19862981 AACAGACCTATTGTGCTGCCAGG - Intergenic
1126479950 15:49107604-49107626 AACTCACTTGTAATGCTGTTTGG - Intronic
1127020332 15:54739626-54739648 AACATACTTATAATGTTGCCAGG - Intergenic
1129546210 15:76398294-76398316 AAAGCACTTAACATGCTGCCTGG - Intronic
1141213480 16:82002471-82002493 AAAGCACTTAGCATGCTGCCTGG - Intronic
1144910423 17:18677136-18677158 AACGCACATATTCTGCTGCTGGG + Intronic
1145127306 17:20312835-20312857 ACTTCACTTATTCTGCTCCCTGG - Intronic
1146777473 17:35634191-35634213 TACTTACTTATTTTGGTGCCAGG + Intronic
1150855692 17:68750471-68750493 AAGTCACTTAGTATGCTGCCTGG + Intergenic
1153654385 18:7270079-7270101 AACTCAGCTCTTCTGCTGCCTGG - Intergenic
1153701261 18:7695733-7695755 AACTACCTTAATATGCAGCCTGG - Intronic
1155596911 18:27498660-27498682 AACTCACTTAATACCCTGCCTGG - Intergenic
1157205140 18:45691631-45691653 AACGCACTTATTGTGGGGCCTGG + Intergenic
1159415776 18:68146940-68146962 AACTCACATATACTGCTGGCAGG + Intergenic
1165167146 19:33864613-33864635 AACTCACCTCATATGCAGCCAGG - Intergenic
926015070 2:9444091-9444113 AAAGCACTTAATATGGTGCCTGG + Intronic
927118523 2:19928735-19928757 AACTCACTTATTATGCTGCCTGG - Intronic
928705592 2:33946442-33946464 AACTGGCTTTTAATGCTGCCTGG + Intergenic
929894360 2:45945618-45945640 AAAGCACTTAGTATGGTGCCTGG - Intronic
933327182 2:80852787-80852809 AACTGAATTAATATGCTGCTAGG + Intergenic
934053180 2:88227434-88227456 AACACACTTAGTATACTGCCTGG + Intergenic
936867935 2:117098171-117098193 AATACATTTATTATGCTCCCAGG + Intergenic
938530337 2:132179170-132179192 AACAGACCTATTGTGCTGCCAGG + Intronic
942959267 2:181810629-181810651 AAATCTCTTATTATAATGCCTGG + Intergenic
945491694 2:210463416-210463438 AACACACTTAAAATGGTGCCTGG + Intronic
947693163 2:232158778-232158800 AACTCATTTATTATTCTCACAGG - Intronic
948122424 2:235540780-235540802 TTCTCACTTTTTATACTGCCCGG - Intronic
1169508875 20:6242769-6242791 AACTCACTTCCCATCCTGCCAGG - Intergenic
1170270420 20:14521415-14521437 AAAGTACTTAGTATGCTGCCTGG - Intronic
1175586351 20:60143619-60143641 AACTTTCTTATTATGCTGACTGG + Intergenic
1176766164 21:13020572-13020594 AACAGACCTATTGTGCTGCCAGG - Intergenic
1180513302 22:16115017-16115039 AACAGACCTATTGTGCTGCCAGG - Intergenic
949321229 3:2812730-2812752 AAAGCACTTAAGATGCTGCCTGG - Intronic
950760461 3:15219526-15219548 AAGTCACTTATAATTCTGACAGG - Intronic
951245510 3:20336906-20336928 AACTCAATTGATATGCAGCCAGG + Intergenic
952179216 3:30900492-30900514 AAATTACTTGTTATGCTTCCTGG - Intergenic
954667359 3:52263666-52263688 AACTCACTGAATATGATGGCAGG + Intronic
966377208 3:179308519-179308541 AACTCCCTTGCTATGTTGCCTGG - Intergenic
967222112 3:187256178-187256200 ACCTCACAAATTATGCTGCTGGG - Intronic
970176248 4:13342209-13342231 GATACACTTATTATTCTGCCAGG - Intergenic
970290434 4:14565308-14565330 AGCTCAATTTTTATGCTGGCTGG - Intergenic
971383762 4:26124757-26124779 AACAGACCTATTATGCTGCCAGG - Intergenic
971591461 4:28474111-28474133 AACTCACTTATTATCATGAGAGG - Intergenic
972020797 4:34310982-34311004 TACTGATTTATTATTCTGCCTGG + Intergenic
972752216 4:42001864-42001886 AACTTACTTATAATACTGTCTGG + Intronic
974728227 4:65824838-65824860 AAATCAGTTCTGATGCTGCCAGG + Intergenic
975758006 4:77590311-77590333 GGCTCACTTATTACGCTGCTGGG - Intronic
977451277 4:97201352-97201374 AACTCATTGATTCTGTTGCCTGG + Intronic
978566866 4:110091990-110092012 AACTAAATTGTTATGCTGGCTGG - Intronic
978665549 4:111177114-111177136 AAGTCACTTATTGTGCTGGCTGG + Intergenic
981928228 4:150162904-150162926 CACTCACTTATTCTGCCTCCTGG + Intronic
982360821 4:154517246-154517268 AACTCACCTAATACGATGCCTGG + Intergenic
982935089 4:161463268-161463290 AATTCAGTTATTTTGCTGTCTGG + Intronic
983483403 4:168303660-168303682 AACACACTTACTGTGCTGCCAGG + Intronic
984404151 4:179304996-179305018 AAAGAACTGATTATGCTGCCTGG - Intergenic
986821891 5:11476339-11476361 AACTCACATAGCATGTTGCCTGG - Intronic
993283696 5:85961149-85961171 AACTAGCTTAATATGCTTCCAGG - Intergenic
994466406 5:100138694-100138716 GCCTCACATATTATGCAGCCAGG - Intergenic
997781751 5:136666618-136666640 AACTCACTTAATAAACTGCCAGG + Intergenic
998764087 5:145465512-145465534 AACTCAGGAATTAAGCTGCCTGG + Intergenic
998788636 5:145742916-145742938 TACTTCCTTATTATCCTGCCTGG - Intronic
1000809785 5:165846725-165846747 AACACATTTATTATGATACCTGG - Intergenic
1010318867 6:74483566-74483588 AACCCAGTTATTATGCTCCTTGG - Intergenic
1010830547 6:80523318-80523340 AACTCATTTGTTATAGTGCCTGG - Intergenic
1011187487 6:84694817-84694839 AAAGCACTTATAATGGTGCCTGG - Intronic
1013673715 6:112433915-112433937 AAAGCACTTAGAATGCTGCCCGG + Intergenic
1014057555 6:117033885-117033907 ACCTCACTTATTTTGCCTCCTGG + Intergenic
1014522891 6:122466795-122466817 TATTCACATATTATGCTTCCTGG - Intronic
1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG + Intergenic
1018782360 6:167079791-167079813 AAATCACATATTATCATGCCTGG - Intergenic
1021773257 7:24026081-24026103 ATACCACTTATTATGATGCCTGG - Intergenic
1026633072 7:72055092-72055114 AACTCATGTACTATGATGCCTGG - Intronic
1028579327 7:92389113-92389135 CCCTAATTTATTATGCTGCCTGG - Intronic
1028831477 7:95331753-95331775 AATTCACTTATGAAGCTACCTGG - Intergenic
1031190860 7:118548781-118548803 AAATCCCTTAGTATCCTGCCTGG - Intergenic
1034863652 7:154622081-154622103 AAGTAACTTATTACTCTGCCAGG + Intronic
1036616953 8:10395594-10395616 GACTCATTCATGATGCTGCCTGG - Intronic
1036961279 8:13247432-13247454 AAAGCACTTAGAATGCTGCCTGG - Intronic
1038230010 8:25691021-25691043 AAAGCACTTATAATGCAGCCTGG - Intergenic
1038347321 8:26744384-26744406 AACTCAATTCTGATGCTACCAGG + Intergenic
1038480215 8:27896640-27896662 AAGTCACTTGTCATGGTGCCTGG - Intronic
1039135782 8:34321336-34321358 AACTCACTCATTGTGATCCCAGG - Intergenic
1041247643 8:55904282-55904304 AACTCAATTATTTGGCTGTCGGG + Intronic
1041524739 8:58792633-58792655 AACTGACTTATTCTGAAGCCAGG - Intergenic
1043124798 8:76377370-76377392 AAACCACTTATCATGATGCCTGG - Intergenic
1044214506 8:89593094-89593116 AACACACTTAATATGTAGCCAGG - Intergenic
1045019729 8:98031425-98031447 AAAACACTTATTATACTGCTTGG - Intronic
1048225831 8:132584568-132584590 AACTCTCTTCTCATGTTGCCTGG + Intronic
1050105311 9:2159588-2159610 AAATCTCTAATTCTGCTGCCTGG + Intronic
1050771808 9:9210788-9210810 AACTTACTAATTTTGCTCCCTGG + Intronic
1053196110 9:36120289-36120311 AACTCCCTTATTTTGCAGACAGG + Intronic
1054748150 9:68876490-68876512 AACTAACGTCTTATTCTGCCTGG + Intronic
1057849976 9:98557664-98557686 AAGTCACTGAGTATGCTCCCTGG - Intronic
1186567765 X:10682369-10682391 AACCTAATTATTATGCTCCCTGG + Intronic
1187054550 X:15730391-15730413 TAATCACTTATTTGGCTGCCTGG + Intronic
1187639335 X:21271436-21271458 AACTCCCTTATAATGCTGCTGGG - Intergenic
1188926810 X:36053909-36053931 AACTCTTTTATTCTGCTACCTGG - Intronic
1193502148 X:82291101-82291123 AAATCTCTTCTTATGCTGCTAGG + Intergenic
1197674465 X:129314542-129314564 GATTCACTTATTATGCTGTCAGG - Intergenic