ID: 927119179

View in Genome Browser
Species Human (GRCh38)
Location 2:19938675-19938697
Sequence CAATCTGAGCAGAGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927119179 Original CRISPR CAATCTGAGCAGAGGGAAAC AGG (reversed) Intronic
900357586 1:2272161-2272183 CCATCTGTGCAGAGGGCAAGAGG - Intronic
901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902798125 1:18812829-18812851 AGATCAGAGCAGAGGGAGACAGG + Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905404626 1:37724551-37724573 GAAGGAGAGCAGAGGGAAACTGG + Intronic
911531416 1:99047638-99047660 CAAACTGAGAAGAAGGAACCTGG - Intergenic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
912132285 1:106618365-106618387 CAATTGGAGCAGAGAGAACCTGG + Intergenic
912553246 1:110497916-110497938 CAACAGGAGCAGAGGGACACTGG + Intergenic
912869403 1:113290273-113290295 CAATCTAAGCAGGGGAAACCAGG - Intergenic
914388016 1:147190877-147190899 CAATCAGAACAGATGGACACAGG - Intronic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
915508266 1:156371048-156371070 CCATCTGAGCAAGGGGAAAAAGG + Intronic
915952573 1:160199217-160199239 CATCCTGAGCAAGGGGAAACAGG + Intronic
917928075 1:179805624-179805646 CAGCTTGAGCAGAGAGAAACTGG - Intronic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
922334846 1:224610511-224610533 CAATCACAGCAGAAGGCAACGGG - Intronic
922905396 1:229170092-229170114 CATTCTGAGCAGAGTCAAACAGG - Intergenic
923497192 1:234535904-234535926 CAAGCTCTGCAGAGGGCAACTGG + Intergenic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1065414338 10:25468095-25468117 CATGCTGAGAAGAGGGAAAGAGG - Intronic
1070311224 10:75275570-75275592 CCATCTGAGGAGGGAGAAACAGG + Intergenic
1071363413 10:84874874-84874896 TTAACTGAGAAGAGGGAAACAGG - Intergenic
1071541957 10:86493457-86493479 CAATCTAGGCAGAGGGATATGGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1074097728 10:110328783-110328805 CAACCTCAGCAGAGAAAAACTGG - Intergenic
1074754015 10:116611139-116611161 GAAACTGAGAAGAGAGAAACTGG + Intergenic
1076472136 10:130726546-130726568 CACTCTGAAAAGAGGGAGACAGG + Intergenic
1077288870 11:1779698-1779720 CAAGCTGGGCAGACGGAAAGGGG + Intergenic
1078473936 11:11614270-11614292 CAATCACAGCAGAAGGTAACAGG + Intronic
1079493502 11:21015393-21015415 CACTATGAGCACAGGGAAAAGGG - Intronic
1082098801 11:48154297-48154319 GAAAGTGAGCAGAGGGAGACGGG + Intronic
1082851868 11:57772440-57772462 CAATCAGGGCATGGGGAAACAGG - Intronic
1083047922 11:59753539-59753561 CCCTCTGAGCAGAGGCAGACAGG + Intronic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1083888852 11:65585746-65585768 CTATCTGATCAGAGGGACCCTGG + Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1085943956 11:81243388-81243410 AAATGTGAGAAGAGGGAAAGAGG - Intergenic
1086055332 11:82640047-82640069 CAATCTGAGCAGAAGGGATGTGG - Intergenic
1090557425 11:127891579-127891601 CAAGCATAGCAGAGAGAAACAGG - Intergenic
1090763084 11:129854168-129854190 GAATCTGAGCAGAGACACACTGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1095618728 12:44223705-44223727 CAATCTGAATAGCAGGAAACAGG - Intronic
1096737028 12:53663688-53663710 GAAACTGAGAAGAGGGAAGCAGG + Intronic
1100188958 12:92170138-92170160 TAATCTGAGCAACAGGAAACAGG - Intergenic
1100761988 12:97817894-97817916 CAATCCAAGCAGATGGAGACTGG - Intergenic
1101161599 12:101982540-101982562 CATTCAGTGCAGAGGAAAACCGG - Intronic
1101175974 12:102151867-102151889 CAAGCTGAGAAGAAGGAACCAGG + Intronic
1101369103 12:104108505-104108527 TAATCTCAGCAGAGGGGATCTGG + Intergenic
1103705196 12:122867529-122867551 CTATCAGAGCAAACGGAAACTGG - Exonic
1104993147 12:132637863-132637885 GAATCTGAGCAGCGTGAAAAGGG - Intronic
1107006544 13:35618976-35618998 CAATATGAGCAGAGCCACACTGG - Intronic
1107024730 13:35788282-35788304 CCAGCTGAGCAGAGAGAAATGGG + Exonic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1111101949 13:83599724-83599746 CAAGAGGAGCAGAGGCAAACAGG - Intergenic
1113242466 13:108353688-108353710 CCATCTCTGCAGGGGGAAACTGG + Intergenic
1116242867 14:42368670-42368692 CCATCAGTGCAAAGGGAAACAGG + Intergenic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1120707115 14:87756541-87756563 AAAACTGAGCAGAGGGATCCAGG + Intergenic
1122326691 14:100884971-100884993 TAATCAGAGCAGAGAGAAATGGG + Intergenic
1124587659 15:31024491-31024513 GGATCTCAGCCGAGGGAAACAGG + Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1129915910 15:79271491-79271513 CAATCTGATAAGGGGGAAAAAGG - Intergenic
1130361950 15:83197432-83197454 CAATCTGAGTAGAGAGAACCTGG - Intronic
1130643873 15:85706424-85706446 GAATCACAGCAGAGGGAACCTGG + Intronic
1131205990 15:90447924-90447946 CAACCTGTGCAGAGTGAAAGGGG - Intronic
1134803520 16:17106541-17106563 CGACCTTAACAGAGGGAAACAGG - Exonic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135603036 16:23799581-23799603 CAATTTTAGTAGAGAGAAACTGG - Intergenic
1136748809 16:32615085-32615107 CAATCAGAAGAGAGGGAAAGAGG - Intergenic
1142289069 16:89184420-89184442 AAATCTCAGGAGAGGGAAATGGG + Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1203050942 16_KI270728v1_random:874299-874321 CAATCAGAAGAGAGGGAAAGAGG - Intergenic
1142753592 17:2002696-2002718 CAATCTCAACAGAGAGAGACGGG - Intronic
1143705134 17:8692292-8692314 CAATCTGAACAGACCGAAAATGG + Intergenic
1144341089 17:14310774-14310796 CAATCAGAGAAGAGGGCACCAGG - Intronic
1144715168 17:17429689-17429711 CATTCAAAGCAGAGGTAAACAGG + Intergenic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1153307500 18:3645577-3645599 CAAGCTATGCAGAGGCAAACAGG - Intronic
1154256132 18:12782250-12782272 CAAGCTGAGAACAGGGAAGCTGG - Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155160360 18:23190384-23190406 CACTGTGAGCCGAAGGAAACCGG + Intronic
1155797621 18:30059916-30059938 CAATCTGTGAGGCGGGAAACCGG - Intergenic
1156892873 18:42209861-42209883 TCAACTGAGCAGAGGGAATCAGG - Intergenic
1157013428 18:43680606-43680628 CAATTTGAACAGAGAGAAAGAGG + Intergenic
1157784567 18:50470154-50470176 AAATCTGAGAAGGGGGAAAGAGG + Intergenic
1159272959 18:66176541-66176563 TAATCTGATCTCAGGGAAACAGG + Intergenic
1161442745 19:4301733-4301755 GAATCAGAGGAGAGGGAAAGAGG + Intronic
1162616920 19:11809302-11809324 CATTATGAGAAGAGGGGAACTGG + Intronic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1165002849 19:32779216-32779238 CAATGTGGGCAGAGGGGCACAGG + Intronic
1165146604 19:33734917-33734939 CAAGCTGAACAGAGGGTAAACGG + Intronic
1166637380 19:44462588-44462610 CTATCTGAGAAGACAGAAACTGG + Intergenic
1167286199 19:48599981-48600003 TATTCCGAGCAGAGGTAAACGGG + Intergenic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
926319938 2:11742750-11742772 CAATCTGACCAGAGGAGAAAGGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
928223121 2:29421773-29421795 CGATCTGGGCAGAGGTACACAGG - Intronic
929332601 2:40701639-40701661 CAATCTGAGCAATTAGAAACAGG + Intergenic
931006452 2:57855455-57855477 CAATCTTGGCAGAAGGAAAAGGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
933392789 2:81693392-81693414 AAATATGACCAGAGAGAAACAGG - Intergenic
934991401 2:98924513-98924535 AAAGCTGAGCAGAGGGAGATGGG - Intronic
936076772 2:109406220-109406242 TAATCAGAGGAGAGGGAAAGAGG + Intronic
936455940 2:112674408-112674430 CCGTCTCAGCAGAGCGAAACAGG + Intergenic
937742223 2:125368762-125368784 CAATCTTAGCAGAAGGCAAAGGG + Intergenic
938193030 2:129300226-129300248 CGGTCTGAGCAGGAGGAAACAGG - Intergenic
939988877 2:148858811-148858833 CAATTTGAGCAGACTAAAACAGG - Intergenic
940908170 2:159187094-159187116 CACCCAGGGCAGAGGGAAACAGG - Intronic
942510038 2:176688310-176688332 TCATCTGAGCAGAGGGAGATGGG + Intergenic
944986001 2:205177905-205177927 CAAACTGAGGACAGGGAGACAGG - Intronic
945950325 2:216033508-216033530 CAAAATAAGCAGAGAGAAACAGG + Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1174457722 20:50661588-50661610 CATTCTGAGGAGAGGCAAAGAGG + Intronic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1183719485 22:39554232-39554254 CAAGCTGGGCTGAAGGAAACTGG - Intergenic
1184330644 22:43825001-43825023 CAACCTGATCCGAGTGAAACAGG + Exonic
950134149 3:10568788-10568810 CATTCTGAGCAGTGGAAACCAGG - Intronic
950854232 3:16090492-16090514 GAATCTGAGAGGAGGGAAACTGG + Intergenic
952648279 3:35689209-35689231 TTATCTGAGCAGGGGGAAACAGG + Intronic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
955133245 3:56191093-56191115 CAACCTGAGCAGAAGGGCACAGG + Intronic
958061530 3:88489028-88489050 CAATGAGAGCAGATGGACACAGG + Intergenic
958674316 3:97247579-97247601 CATTCTGAGTAGAAGGAACCAGG + Intronic
959391252 3:105777112-105777134 AAAGCAGAGCAGAGGGTAACAGG + Intronic
963956566 3:151260932-151260954 CAGTCTGGGGAGATGGAAACTGG - Intronic
964621892 3:158727031-158727053 CAATCATGGCAGAGGGCAACAGG - Intronic
964640794 3:158908100-158908122 AAATCTGACCACAGGAAAACTGG - Intergenic
965493797 3:169372924-169372946 CATGCGGAGCAGTGGGAAACAGG - Intronic
967208298 3:187144403-187144425 CAATCATAGCAGAGGGCAAAGGG + Intronic
968206292 3:196804056-196804078 AAATCTAAACTGAGGGAAACAGG - Intronic
968262723 3:197338164-197338186 CAAGCTCATCAGATGGAAACAGG + Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969194780 4:5551921-5551943 CAATCATGGCAGAGGGAAAGAGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
972713822 4:41625762-41625784 CAATTTGAGCAGGGAGAATCTGG - Intronic
973905772 4:55528804-55528826 CAAACTGAACAGAAAGAAACTGG + Intronic
975837776 4:78442476-78442498 CACCCTGGGCAGAGGGAAAGTGG + Intronic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977378840 4:96243669-96243691 CAACATGAGTAGAGAGAAACTGG + Intergenic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
977770343 4:100850510-100850532 CCATCTGAGTACAGAGAAACTGG + Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
981244271 4:142515632-142515654 AACTCAGAGCAGTGGGAAACAGG + Intronic
983996956 4:174193712-174193734 AGCTCTGAGCTGAGGGAAACAGG + Intergenic
984785020 4:183559899-183559921 TAATCAGAGCAGAGGGATAATGG - Intergenic
985417839 4:189754428-189754450 CAATCATGGCAGAAGGAAACAGG - Intergenic
985804858 5:2035616-2035638 CGAACTGAGAAGAGAGAAACTGG - Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
986748680 5:10765500-10765522 CAATCTGTGACGCGGGAAACCGG + Intergenic
991172630 5:63646351-63646373 AAATCTGAGCTAACGGAAACAGG - Intergenic
991523156 5:67523704-67523726 CAATGAGAACAGAGGGACACAGG - Intergenic
993448711 5:88046911-88046933 GACTCTGAGCAGGGGGAAAGGGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
997093642 5:130885904-130885926 ATATTTGAGCTGAGGGAAACAGG + Intergenic
997978906 5:138457061-138457083 CAACTGGACCAGAGGGAAACTGG + Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001778134 5:174344525-174344547 CACTCTGAGCACAGGAAAAAGGG + Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1005084590 6:21992063-21992085 AAAGCTGAGCAGAGGGGAAAAGG - Intergenic
1006613942 6:35312195-35312217 GAGCCTGGGCAGAGGGAAACAGG - Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1008552197 6:52644064-52644086 CATTCCGAGCAGAGGCAGACAGG + Intergenic
1008606051 6:53140677-53140699 CAACCTGAACTGAGAGAAACTGG + Intronic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1015661108 6:135574307-135574329 GAATCTGAGAAGAGGAAAGCTGG - Intergenic
1017696008 6:157017042-157017064 CACACTAAGCAAAGGGAAACAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1023744056 7:43305555-43305577 CAACCTGAGAATAGTGAAACTGG + Intronic
1023805595 7:43870575-43870597 CACACTGAGAAGAGGGAAAGAGG + Intronic
1025059715 7:55795417-55795439 GAATCTGAAAAGAGGGACACAGG + Exonic
1026989461 7:74575447-74575469 AGTTCTGAGCAGAGGGTAACAGG + Intronic
1028016165 7:85716136-85716158 AAATATGAGCAGAGGGCAAATGG - Intergenic
1030300796 7:107972647-107972669 CAATCTAAGCACATGGAAAATGG - Intronic
1030551332 7:110964108-110964130 CAATCGTAGCAGAAGGATACGGG - Intronic
1031619101 7:123914521-123914543 CAATGTGAGCAGAGGTGAAAGGG + Intergenic
1035491268 7:159280927-159280949 AAATCTCAGCACAGGGAAATGGG - Intergenic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1035812029 8:2500581-2500603 CAGTCTGAGGATAGGAAAACAGG - Intergenic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1038237666 8:25776379-25776401 GATTCTGAGCATAGGGAAAGAGG - Intergenic
1038926997 8:32151683-32151705 AAATCTGAGCAGGGGGAACCTGG + Intronic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1043254711 8:78119707-78119729 GAATCTGATCTGAGGGAGACAGG + Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1046246465 8:111569637-111569659 CAATCAGAGAAGAGAGAAATTGG - Intergenic
1048840071 8:138557853-138557875 GAATCTGGGTAGAGGGAAAAAGG + Intergenic
1051463286 9:17348427-17348449 CAATGTCAGCAGAGGAAAAGAGG - Intronic
1051728407 9:20112689-20112711 AAATCTGAGCAGGGAGAAAAAGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1056914436 9:90733326-90733348 CAATCTGTGAGGTGGGAAACTGG - Intergenic
1059135797 9:111805033-111805055 CAATATGAGAAGGGGCAAACAGG - Intergenic
1060070235 9:120540786-120540808 CACTCTGATCAGAGAGGAACAGG - Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1060707378 9:125816327-125816349 CAGTCCTATCAGAGGGAAACTGG + Intronic
1185548402 X:964634-964656 CGATGAGAACAGAGGGAAACAGG - Intergenic
1186769002 X:12799024-12799046 CAAACTCAGCAAAGGGAAAAAGG - Intronic
1186991772 X:15077212-15077234 GAATAAGAGCAGAGGGAAAGGGG + Intergenic
1187793185 X:22973094-22973116 CCAGCTGAGCAGTGAGAAACTGG + Intergenic
1188565784 X:31524540-31524562 GAATCTTATCAGAGTGAAACCGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190018455 X:46850028-46850050 CAGTCTGAGCAGACTAAAACAGG + Intronic
1191198413 X:57750051-57750073 CAATGAGAGCACAGGGACACAGG + Intergenic
1197853746 X:130892509-130892531 GAATCTGAGAAGAGGGCCACAGG - Intronic
1200822064 Y:7596437-7596459 CTATGTGAGCAAAGGGAGACAGG + Intergenic
1200878246 Y:8182717-8182739 AAGTCTGAGCACAGTGAAACTGG - Intergenic