ID: 927123001

View in Genome Browser
Species Human (GRCh38)
Location 2:19986029-19986051
Sequence CTGGAGCTATAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927122996_927123001 -2 Left 927122996 2:19986008-19986030 CCAGGTGAGGGATGATGGTAGCT 0: 1
1: 3
2: 36
3: 171
4: 576
Right 927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG 0: 1
1: 0
2: 3
3: 35
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927123001 Original CRISPR CTGGAGCTATAGAGGGAGCA GGG Intronic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
903565520 1:24262461-24262483 CTGGAGCCTTGGAGGGAGCATGG - Intergenic
903776203 1:25795469-25795491 CTGGGGCTATAGTGGGAGACCGG - Intergenic
904605219 1:31694500-31694522 CTGGATTGAAAGAGGGAGCAGGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905184498 1:36186806-36186828 CTAGAGATTGAGAGGGAGCATGG + Intergenic
907195601 1:52684072-52684094 CAGGAGCAAGAGAGTGAGCAAGG - Intergenic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909125123 1:71658042-71658064 CTGGAGCTGTGCAGGGATCATGG - Intronic
910629885 1:89343637-89343659 CTGGACCTATAGAGGGAGAGAGG - Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
912079134 1:105913217-105913239 CTGGACTTATAGAGGGAGAAAGG - Intergenic
913023445 1:114810200-114810222 CTGGAGATATGGACGGAGCTGGG + Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
915016605 1:152739999-152740021 CTGGAGCAATGGAGGACGCAAGG - Intronic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
917186733 1:172364828-172364850 CAGTAGCAAGAGAGGGAGCAGGG - Intronic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
918430563 1:184455678-184455700 CTGGAGCTATGATGGGAACAAGG - Intronic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
919046716 1:192461885-192461907 GTGGAGATCTAGAAGGAGCATGG + Intergenic
920974325 1:210771398-210771420 CAGGAGCTGAAGAGGCAGCAAGG + Intronic
921967434 1:221105352-221105374 GTGGAGGTATAGAGGGAGTGGGG + Intergenic
922418957 1:225446824-225446846 CTGGAGCTTTAGGGCCAGCAGGG - Intergenic
922541596 1:226424376-226424398 CTGAAGCTACAGGGAGAGCAAGG + Intergenic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
924569874 1:245228170-245228192 CTGGAACAATAGGGAGAGCAAGG - Intronic
924610010 1:245565844-245565866 CTGCAGCTGTACAGGAAGCATGG + Intronic
1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG + Intronic
1065666671 10:28070706-28070728 CTGGACATATATAAGGAGCAAGG + Intronic
1066389066 10:34964304-34964326 GTGTGGCTAAAGAGGGAGCAAGG + Intergenic
1066713887 10:38265711-38265733 ATGGAGCTGTTCAGGGAGCAGGG - Intergenic
1067530174 10:47065205-47065227 CTGAAGCCTTAGCGGGAGCATGG - Intergenic
1067701328 10:48575097-48575119 CAGGAGCAAAAGAGAGAGCAGGG - Intronic
1071480453 10:86061267-86061289 GTGGAACTATAGTGGGAGCTGGG - Intronic
1073729834 10:106274347-106274369 CTGGGCCTATAGAGGGAGAAAGG - Intergenic
1073841167 10:107500792-107500814 GTGGAGCTAAAGAGGAAGCCAGG + Intergenic
1074156738 10:110806436-110806458 CAGGAGTTAGAGTGGGAGCAGGG + Intronic
1074728581 10:116342912-116342934 TGGAAGCTATAGAGGGAGCATGG - Intronic
1074824675 10:117206219-117206241 CTAGAGCCTTAGAGGGAGTATGG - Intronic
1075163401 10:120044214-120044236 CTGGAGCTGTTGAGGGAGGGTGG - Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1078005170 11:7527141-7527163 CTTGGGCCATAGAGTGAGCAAGG + Intronic
1079128330 11:17734169-17734191 CTGAAGCTATAAAGGGCCCAGGG + Intergenic
1079140836 11:17808400-17808422 CAGGAGCAAAAGAGCGAGCAGGG + Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1081180735 11:39983589-39983611 CTGCAGCTTTACAGGAAGCATGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081878526 11:46428096-46428118 CTAGCGCTCTAGAGGGAGAAGGG + Intronic
1082208369 11:49467096-49467118 GTGGACCTATAGAGGGAGAGAGG + Intergenic
1083172404 11:60930738-60930760 CTGGGGATCTAGAGGCAGCATGG - Intronic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083621453 11:64051363-64051385 CACGAGCTAGAGAGGCAGCAGGG + Intronic
1083732287 11:64659092-64659114 CTGGACCTAGAGGGGAAGCAGGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084191675 11:67502262-67502284 CTGGAGCTATGGGGGGACCCTGG - Intronic
1084591264 11:70092042-70092064 CTGGAGTCTTAGAGGGAGCGCGG - Intronic
1085057590 11:73415667-73415689 CTGGAGCTATAGCCTGAGCTTGG + Intronic
1085241798 11:75062642-75062664 CAGGAGCAAGAGAGAGAGCAAGG - Intergenic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1087152269 11:94869541-94869563 GTTGAGCTAGAGAGGAAGCAGGG + Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088764213 11:112961190-112961212 CTGGAGCTTTTGGGGGAGCCGGG - Intergenic
1089714662 11:120346763-120346785 CTGGAGTAATAAAGGGAACAAGG - Intronic
1090231636 11:125111276-125111298 CAGGAGCTAGAGAGGGATTAAGG + Intronic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091697191 12:2635719-2635741 CTGGAGCTATAGGGTGAGCAGGG - Intronic
1092088287 12:5783821-5783843 CTGGAGCCCTAGTGGGAGAAGGG - Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1096781056 12:53992339-53992361 ATGGAGCTATAGAAGGGGAAGGG - Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097971807 12:65640902-65640924 CTGGAGCTAGAGAAGCGGCAGGG - Intergenic
1099674075 12:85734142-85734164 CTAGAGCTGTGGAGAGAGCATGG - Intergenic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1100874139 12:98944420-98944442 CTAAAGCTATACAGGAAGCATGG - Intronic
1101086975 12:101246191-101246213 CTGGAGCTATGTAGGGGGCCTGG + Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101913727 12:108880058-108880080 CTGGAGCTATGGACAGGGCACGG - Exonic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1103972674 12:124681912-124681934 CAGGGGCTTTGGAGGGAGCAGGG - Intergenic
1103990464 12:124795643-124795665 GTGGAGGTTGAGAGGGAGCATGG - Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1105983410 13:25541971-25541993 CTGGAACTATAGAGTGTGAAGGG + Exonic
1106270286 13:28146386-28146408 CTGGATCTATGGGGGGAGGAGGG - Intronic
1106467024 13:30022664-30022686 GTGGAGCCATAAAGGAAGCAGGG - Intergenic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1107230127 13:38098934-38098956 CTGGAGCAAGAGAGAGAGCAGGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108368530 13:49743273-49743295 ATGGAGCAATAGAGAGAGCAAGG + Intronic
1109548620 13:63861449-63861471 CTGTAGCTGTACAAGGAGCATGG - Intergenic
1111436467 13:88216249-88216271 CTGGTGTTTTAGAGGGAGCATGG + Intergenic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112235769 13:97634862-97634884 CAGGAGCAAGAGAGAGAGCAAGG + Intergenic
1113062502 13:106338311-106338333 CAGGAGCAAGAAAGGGAGCAGGG - Intergenic
1113344962 13:109468141-109468163 TTGGAGCTAAAGAGGTGGCATGG - Intergenic
1113382999 13:109820795-109820817 CTGGAGCCTTCGAGGGAGCATGG - Intergenic
1114674506 14:24431376-24431398 CTGGAGCTCAGGAGCGAGCAAGG + Intronic
1118424936 14:65650474-65650496 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1118841389 14:69515680-69515702 CAGGAGCAAGAGAGAGAGCATGG + Intronic
1119644684 14:76339768-76339790 CTGGGGCCATAGAGGCAGCCAGG - Intronic
1121742424 14:96263693-96263715 TTGGAGCTCTAGAGGGGGCCAGG - Exonic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1129280582 15:74481609-74481631 CTGGAGCCAAGGAGGGTGCAGGG + Intergenic
1132103250 15:99043159-99043181 CCAGAGTTACAGAGGGAGCATGG + Intergenic
1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134090684 16:11390265-11390287 CTGGAGCTGGTGAGTGAGCAAGG - Exonic
1134689498 16:16182001-16182023 CTGGAGCTATGGATTGGGCAGGG - Intronic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1136531555 16:30873353-30873375 CTAGAGCTGTAGTGGGAGGAAGG + Intronic
1136655519 16:31706874-31706896 CTGGGGCTGCAGAGGGACCAGGG - Intergenic
1137725597 16:50654727-50654749 CTGGAGTTAGAGAGGGAGGGAGG + Intergenic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1139626986 16:68198027-68198049 CGGGAGTTATAGACTGAGCATGG + Intronic
1140716086 16:77726963-77726985 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1140918653 16:79516774-79516796 CTGGAGCTCTAGAGGTTCCATGG + Intergenic
1141492694 16:84385234-84385256 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1142112237 16:88339127-88339149 CTGGAGCGAGAGTGGGAGCCAGG + Intergenic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1145813389 17:27778575-27778597 CTGGACCTCTAGAGTGAGCAAGG + Intronic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1152014565 17:77741928-77741950 CTGCTGCTTTAGAGGGAGCCAGG - Intergenic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1153279719 18:3403285-3403307 CTAGAGCTTTTGAGAGAGCATGG + Intergenic
1153691673 18:7600683-7600705 CTGCAGCTAGTGAGGAAGCAGGG - Intronic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1155762512 18:29585811-29585833 CTGTAGCTATCGACCGAGCATGG + Intergenic
1155839210 18:30626766-30626788 CTGGTCCTATAGAGGGAGAAAGG + Intergenic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157367838 18:47082615-47082637 GCGCAGCTATAAAGGGAGCAAGG - Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1158330438 18:56356592-56356614 ATGCGGTTATAGAGGGAGCATGG - Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1165282597 19:34809883-34809905 CTGTAGCTGTACAGGAAGCATGG - Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1168061489 19:53895106-53895128 CTGGGGATATAGAGAAAGCAGGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
925863177 2:8200091-8200113 CTGAAGCTAAAGGGGAAGCAAGG + Intergenic
926028263 2:9563604-9563626 CTGGGCCTTCAGAGGGAGCATGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927054951 2:19358863-19358885 CTGGACCTAAAAAGGCAGCAGGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
928356620 2:30622065-30622087 CTGGAGCTATTGAGGGGACACGG + Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929339792 2:40801504-40801526 GTGGAGCTATGAAGGGAGGAAGG - Intergenic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
930259593 2:49129603-49129625 CTGGAGCTGAAGATGTAGCATGG + Intronic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
931510057 2:62981757-62981779 CTGGATCTATAGAGTTGGCAAGG + Intronic
931617468 2:64174663-64174685 ATCAAGCTATAGAGGGAGAAGGG - Intergenic
931671113 2:64648707-64648729 CTGGAGCTTTAGAAGGAGGCAGG + Intronic
931883104 2:66587505-66587527 CTGGAGCTATGGAAGGAATAAGG + Intergenic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
936082804 2:109446490-109446512 CTGGAGCTAGAGCAGGAGCAGGG + Intronic
936672448 2:114673233-114673255 GTGGAACTATGGAGGGAGCAAGG - Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
942851584 2:180494291-180494313 TAGAAGCTATAGAGGGAGTAGGG + Intergenic
943302734 2:186223783-186223805 CCCAAGCTATAGAGGGAACAAGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943907227 2:193515068-193515090 CTTCAGCTATATAGGAAGCATGG + Intergenic
945580425 2:211587550-211587572 CTAGAGACTTAGAGGGAGCATGG + Intronic
946224836 2:218258907-218258929 CTGGACCAATGGAGGCAGCAGGG - Intergenic
946591967 2:221259933-221259955 GTGGAGCTCTGGAGAGAGCATGG + Intergenic
948802250 2:240438251-240438273 CTGCAGCCATAGGGGGTGCAGGG - Intronic
948861537 2:240755015-240755037 CAGGAGCTGCAGAGAGAGCAGGG - Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1171266699 20:23776883-23776905 TAGGACCTAGAGAGGGAGCACGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1173631740 20:44521615-44521637 CTGGAGCTGGAGAGGGACCAAGG - Intronic
1173759068 20:45543860-45543882 ATGGAGGTATAGAGGTAGCACGG - Intronic
1173984497 20:47250554-47250576 CCTGAGGTATGGAGGGAGCAGGG - Intronic
1174096601 20:48094531-48094553 CTGGAGCTATAAAAAGAGCAGGG + Intergenic
1174455867 20:50648434-50648456 CCGCTGCTTTAGAGGGAGCATGG - Intronic
1175370193 20:58483142-58483164 CAGGAGCTGTAAAGGTAGCAGGG + Intronic
1175707474 20:61191232-61191254 CTGGAGCTGTAAAGGCCGCAGGG - Intergenic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1180231749 21:46430550-46430572 CAGGAGCTGGAGAGTGAGCAGGG + Exonic
1181174448 22:21027822-21027844 CTGGAGATTGAGAGGCAGCAGGG - Exonic
1181960712 22:26619816-26619838 CTGGGGCTTTAGGGGGGGCACGG - Intergenic
1183673573 22:39287495-39287517 CTGGAGCTGTGGAGGCAGCATGG - Intergenic
1183890923 22:40927926-40927948 AAGAATCTATAGAGGGAGCAGGG - Exonic
1184895031 22:47401711-47401733 GAGGGGCTGTAGAGGGAGCAGGG - Intergenic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
953031718 3:39184176-39184198 CTGGAGCTACAGACGGGGCCAGG - Exonic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
957679464 3:83414193-83414215 CTGAAGCTAAAAAGGCAGCATGG - Intergenic
959368296 3:105491140-105491162 CTGTGGCTTTAGAGGGTGCAAGG - Intronic
959485110 3:106919642-106919664 CAGGAGTTACAGAGGAAGCAGGG + Intergenic
961064357 3:123862006-123862028 CTGGAGCTCTGGAGTGGGCAGGG - Intronic
963762058 3:149294284-149294306 CTGGGCCTATAGAAGGAGAAAGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
968012089 3:195289450-195289472 CTGGTGCTATATAGATAGCATGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969896536 4:10310424-10310446 TTGGTGCTCTAGAGGGACCAAGG - Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
971747173 4:30597903-30597925 CTAGGGATATAGAGGCAGCATGG - Intergenic
973034591 4:45390465-45390487 CTGGTGCCCTAGAGGGATCAAGG + Intergenic
974110070 4:57514986-57515008 CTGCAGCAATACAGGGAGCTGGG - Intergenic
975487498 4:74950295-74950317 CTGGAGCTTCAGAGGAGGCATGG - Intronic
977128265 4:93198649-93198671 CTGGAGTTAGAGAGGTAGGATGG + Intronic
977362857 4:96028812-96028834 CAGAAGCTGTACAGGGAGCATGG + Intergenic
978927072 4:114259898-114259920 CTCCAGCTAAAGAGAGAGCAAGG - Intergenic
979463198 4:121006506-121006528 CTGGAGCTATAGACACAACATGG + Intergenic
980347462 4:131639902-131639924 CTGGACTTATAGAGTGAGCTTGG - Intergenic
981322751 4:143411585-143411607 CTGGAGCTACCAAGGCAGCAAGG + Intronic
982507565 4:156239442-156239464 CGGGAGCAAGAGAGGGAACAAGG - Intergenic
982586696 4:157250407-157250429 CTGGTGCTAAACATGGAGCAGGG + Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
986293966 5:6422244-6422266 CTGGAGCTTTGGAGGGAGCGTGG + Intergenic
986470453 5:8068496-8068518 GTGGGGCTAGAGAGGGAGTATGG + Intergenic
986632216 5:9784680-9784702 CTGGAGCTTCTGAGGGAGCGGGG - Intergenic
988580063 5:32460945-32460967 CAGGAGCAAAAGAGAGAGCAGGG - Intergenic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
992648206 5:78832053-78832075 CCGGAGCTATAAGGAGAGCAAGG - Intronic
993630631 5:90281998-90282020 CTGGAGCTAAAGAGGGCACATGG - Intergenic
993948600 5:94145708-94145730 TTGGAGCTAAAGAGAGAGCTAGG + Intergenic
994109674 5:95987117-95987139 CTGGAGCTGTGGGGGCAGCAAGG - Intergenic
994775130 5:104030354-104030376 CTGGGCCTATAGAGGGAAAAAGG - Intergenic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997651095 5:135521519-135521541 CTGCAACTATACAGGAAGCATGG + Intergenic
999971038 5:156863659-156863681 CAGGAGCTATAAAGCAAGCAAGG - Intergenic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004345620 6:14846560-14846582 CAGGTGCTCAAGAGGGAGCAGGG + Intergenic
1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG + Intronic
1006813322 6:36834957-36834979 CTGGAGCCAGAGAGGCAGCCCGG - Intronic
1007082505 6:39117809-39117831 CTGTAGCTATAGGAGAAGCAAGG + Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1009033372 6:58087159-58087181 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009208985 6:60838928-60838950 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1013074036 6:106754744-106754766 CTGGACCTATAGGGTGAGCAAGG + Intergenic
1014986850 6:128021778-128021800 CTGGAGTTTTAGAAGGAGCAAGG + Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1016268680 6:142261956-142261978 CAGGAGTGAGAGAGGGAGCAAGG - Intergenic
1018239780 6:161761990-161762012 CTGGAGCTACAGAGCGAGAGTGG + Intronic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1019658892 7:2212698-2212720 CTGCAGCTGTACAGGAAGCATGG - Intronic
1021102799 7:16602954-16602976 CTGAAGGTATACAGGAAGCATGG - Intronic
1024454941 7:49594693-49594715 TTGGAGCTATTGAGGTAGCTGGG + Intergenic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1030265053 7:107611778-107611800 ATGCAGCTATAGAAGGAACATGG + Intronic
1031480792 7:122276160-122276182 CTGCAGCTGTACAGGAAGCATGG - Intergenic
1031533031 7:122899362-122899384 TTGGTGCTATAGATGGAACAAGG + Intergenic
1031817470 7:126455772-126455794 CTGGTGCTATAGAGGTGGAATGG - Intronic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1033021940 7:137734235-137734257 CAGTAGCTAGAGTGGGAGCAGGG + Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034563712 7:151897222-151897244 GTGGGGCTGGAGAGGGAGCAAGG + Intergenic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039036075 8:33360570-33360592 CTTGAGCTATAGGGGGTGTAGGG - Intergenic
1039811104 8:41049102-41049124 CTGTTGCTATTGAAGGAGCATGG + Intergenic
1040721459 8:50329516-50329538 CTGTTGCTTTAGAGGGTGCAAGG - Intronic
1041721049 8:60975591-60975613 CTGGAGCTTCAAAGGGACCATGG + Intergenic
1043178836 8:77057905-77057927 CAGGAGCTAGAGAGAGAGTAAGG + Intergenic
1045388714 8:101694224-101694246 CTGGAGCTCTAGGGGCAGCAAGG + Intronic
1048005068 8:130412395-130412417 CAGGAGCAAGAGAGAGAGCAAGG - Intronic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048123650 8:131608671-131608693 CTGGGGGTATAGAGGGATCTGGG - Intergenic
1048803886 8:138221285-138221307 TAGGAGCAATAGAGAGAGCAGGG + Intronic
1048898480 8:139015996-139016018 CAGTAGCTATAGAAGGTGCAAGG + Intergenic
1048993849 8:139776918-139776940 CAGGAGCTACAGAGGGTGCAAGG - Intronic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1050180849 9:2921064-2921086 CTGGAGCTACTGAAGAAGCAAGG - Intergenic
1050427330 9:5524930-5524952 CTGGGGCTGTACAAGGAGCAAGG - Intronic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1056053847 9:82799989-82800011 CAGGAGCTTTGGAGGAAGCAGGG + Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056397936 9:86198410-86198432 CTGCAGCTGTACAGGAAGCATGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056947346 9:91009980-91010002 CAGGAGCAAGAGAGAGAGCAGGG - Intergenic
1057009596 9:91589725-91589747 TTGGCGCTGTGGAGGGAGCAGGG + Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1059991087 9:119867425-119867447 GAGGAGGTAGAGAGGGAGCAAGG + Intergenic
1060238913 9:121886540-121886562 CTAGAGCTTTGGAGGGGGCATGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1185645029 X:1610012-1610034 CTGGAGCTTTGGCTGGAGCAGGG - Intergenic
1185826365 X:3255100-3255122 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1187122289 X:16421145-16421167 CTGGAGCAAGAGAGAGAGCAAGG + Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187322522 X:18252883-18252905 CTGGAGCTATACAGGAAGCTGGG + Intronic
1189413305 X:40792541-40792563 CTGGGCCTATAGAGAGAGAAAGG + Intergenic
1190620860 X:52285280-52285302 CTGCAGCCATACAGGGGGCAGGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1191720899 X:64227672-64227694 CTGGAGCTAAAGAGAGAGCTGGG - Intronic
1192033825 X:67543786-67543808 CAGGAGCTATTCAGGAAGCAGGG + Intergenic
1192527956 X:71863762-71863784 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1193049906 X:77088858-77088880 CTGGAGCTATAAAGGGAACTAGG + Intergenic
1193330327 X:80229181-80229203 CTGGGCCTAGAGAGGGAGAAAGG - Intergenic
1193599227 X:83488727-83488749 CTGGAGTGAAACAGGGAGCAAGG + Intergenic
1195540540 X:106057780-106057802 CTAGACCTACGGAGGGAGCATGG - Intergenic
1195721436 X:107872661-107872683 CTGGGCTTATAGAGGGAGAAAGG + Intronic
1198313479 X:135443748-135443770 CTGCAGCTGTACAGGAAGCATGG + Intergenic
1198518662 X:137431174-137431196 ATAGAGATAGAGAGGGAGCAGGG - Intergenic
1198640548 X:138751216-138751238 ATGGGGCAATAGAGGGTGCAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198979106 X:142374572-142374594 CAGGAGCAAGAGAGGGAGCGGGG - Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1199895083 X:152119838-152119860 ATGGAGCTATAGAGGGGTAAGGG + Intergenic
1201675663 Y:16580886-16580908 CTTGGGCTATTGAGGAAGCATGG - Intergenic
1201771785 Y:17622891-17622913 CTGGGACCATAGAGGGACCAGGG + Intergenic
1201829770 Y:18283095-18283117 CTGGGACCATAGAGGGACCAGGG - Intergenic