ID: 927125004

View in Genome Browser
Species Human (GRCh38)
Location 2:20005966-20005988
Sequence GCCCTCTTCTAACATCCCTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927125004_927125012 29 Left 927125004 2:20005966-20005988 CCTTAGGGATGTTAGAAGAGGGC 0: 1
1: 0
2: 3
3: 9
4: 109
Right 927125012 2:20006018-20006040 TTCGTCCATTGCTGTCTGGATGG 0: 1
1: 0
2: 0
3: 9
4: 101
927125004_927125011 25 Left 927125004 2:20005966-20005988 CCTTAGGGATGTTAGAAGAGGGC 0: 1
1: 0
2: 3
3: 9
4: 109
Right 927125011 2:20006014-20006036 AGGCTTCGTCCATTGCTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 61
927125004_927125005 5 Left 927125004 2:20005966-20005988 CCTTAGGGATGTTAGAAGAGGGC 0: 1
1: 0
2: 3
3: 9
4: 109
Right 927125005 2:20005994-20006016 AGCCCCTGCCTCCACTGTGAAGG 0: 1
1: 0
2: 2
3: 40
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927125004 Original CRISPR GCCCTCTTCTAACATCCCTA AGG (reversed) Exonic