ID: 927126597

View in Genome Browser
Species Human (GRCh38)
Location 2:20017527-20017549
Sequence CTGTGAATAAGCAGAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927126594_927126597 28 Left 927126594 2:20017476-20017498 CCTGGGCGACAGAGTGAGACCCT 0: 1124
1: 19175
2: 72238
3: 162352
4: 214357
Right 927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG No data
927126595_927126597 9 Left 927126595 2:20017495-20017517 CCCTGTCTCAATCAATCAATCAG 0: 10
1: 123
2: 132
3: 205
4: 1340
Right 927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG No data
927126596_927126597 8 Left 927126596 2:20017496-20017518 CCTGTCTCAATCAATCAATCAGT 0: 11
1: 117
2: 131
3: 169
4: 700
Right 927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927126597 Original CRISPR CTGTGAATAAGCAGAAAACA TGG Intergenic
No off target data available for this crispr