ID: 927130025

View in Genome Browser
Species Human (GRCh38)
Location 2:20051284-20051306
Sequence TGGAGGGGCGCTGCTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927130025_927130042 30 Left 927130025 2:20051284-20051306 CCTTAAAAAGCAGCGCCCCTCCA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 927130042 2:20051337-20051359 AGTCTCACCCCCTCCGCACCAGG 0: 1
1: 0
2: 2
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927130025 Original CRISPR TGGAGGGGCGCTGCTTTTTA AGG (reversed) Intronic
902605030 1:17564320-17564342 TGGAGGGGGGCTGCTTTGAGAGG + Intronic
903769878 1:25757160-25757182 TTGAGGGGTGCTGCTTTTCCTGG - Intronic
904296646 1:29523675-29523697 CTGAGAGGCGCTGCTTCTTAAGG - Intergenic
911074217 1:93856797-93856819 GGGAGGGGCTCTGATTTTTAGGG - Intergenic
913516571 1:119610406-119610428 TGGAGGGCCCCAGCTTTTTTGGG + Intergenic
916319067 1:163482065-163482087 TGGGAGGGTGCTGATTTTTAAGG - Intergenic
916480804 1:165212703-165212725 TAAATGGGCGCTGCTATTTATGG + Intronic
923231021 1:231986338-231986360 TGTAGGGGAACTGATTTTTAGGG + Intronic
1063925127 10:10969986-10970008 TGGAGGGGGGCGGCTTCTAATGG + Intergenic
1065621963 10:27591225-27591247 TGAAGGGGTGTTGCATTTTATGG - Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1078514175 11:12008749-12008771 TGTAGGGGAGCTGCGTTTTCAGG - Intronic
1082711004 11:56554109-56554131 GAGAGGCGCTCTGCTTTTTAGGG + Intergenic
1083116475 11:60464448-60464470 TGGAGGGTCTTTGCTTTTTAGGG - Intronic
1085782507 11:79422519-79422541 TGCAGGGCCTCTGCTTTTTTTGG - Intronic
1088884958 11:113999073-113999095 TGGAGGGGCGCTGCTGGCAAAGG + Intergenic
1090887866 11:130895140-130895162 TGGAGGGGCGCTGCACTCTTTGG + Intronic
1094011582 12:25815699-25815721 TGGTTGGGGGCTGCTTTTGAAGG - Intergenic
1096813873 12:54189232-54189254 TGGAAGGGCGATGCCCTTTAGGG - Intergenic
1097960714 12:65529602-65529624 TGGAATGGCCCTGCTTTTAATGG + Intergenic
1098303207 12:69075688-69075710 TGGAAGGGCACTGCTTTAGAAGG + Intergenic
1100412571 12:94336271-94336293 TAGAGCTGCTCTGCTTTTTAAGG - Intronic
1100919363 12:99464367-99464389 GAGAGGTGCTCTGCTTTTTAGGG - Intronic
1114792811 14:25679029-25679051 TGGCAGGGCGGTGCTTTTTCTGG + Intergenic
1117115212 14:52503650-52503672 TAGAGGTGCCCTGATTTTTAGGG - Intronic
1118513167 14:66498736-66498758 TGGAGAGAAGCTCCTTTTTATGG - Intergenic
1119623670 14:76152121-76152143 TGGTGGGGCCTTGCTTTTCAGGG + Intronic
1120360729 14:83498631-83498653 TGGAGAGAAGCTGCATTTTATGG + Intergenic
1127925870 15:63540633-63540655 TGGAGGGGCACTGCTCTACAAGG - Intronic
1128462145 15:67878502-67878524 TGGAGGGGGGATGTGTTTTAAGG - Intergenic
1141028104 16:80566673-80566695 TGGGGAGTGGCTGCTTTTTAAGG + Intergenic
1148251938 17:46089462-46089484 TGGTGGGGCTTTTCTTTTTAAGG - Intronic
1149445105 17:56707464-56707486 TGGAGGAGCCCTGCTCTTTGGGG + Intergenic
1152220276 17:79060493-79060515 TGGATGAGAGCTGCTTCTTAGGG + Intergenic
1153534620 18:6087512-6087534 TGGAGGGGGGCTGCTCTGAAAGG + Intronic
1156804777 18:41164980-41165002 TGGAGAGGAGCTGCTCTTTGAGG - Intergenic
1160955730 19:1690968-1690990 TGGAGGGGCGCTGCCTTGTGTGG - Intergenic
1161236437 19:3200728-3200750 TGGGGAGGGGCTGCTTTTTGGGG - Intronic
1163358270 19:16829306-16829328 TTGAGGGGCGGTGCTCTTTGAGG - Intergenic
926679069 2:15650288-15650310 TGAAGGGGTGCTGGTTTTTTTGG - Intergenic
927130025 2:20051284-20051306 TGGAGGGGCGCTGCTTTTTAAGG - Intronic
935639394 2:105276397-105276419 TGGAGGGGTGGTGCTGTGTATGG - Intronic
1172831900 20:37843005-37843027 TGGAGGGGCTGTGCTTACTATGG + Intronic
1179421791 21:41242199-41242221 TGGAAGGGCACTGCTTTCTGTGG + Intronic
1180258508 21:46650623-46650645 TGAATGGGCGCTGCTGTTCAGGG - Intronic
951497878 3:23350311-23350333 GAGAGGTGCTCTGCTTTTTAGGG - Intronic
952493891 3:33899106-33899128 TGGAAGGGAGAGGCTTTTTATGG + Intergenic
954642348 3:52108662-52108684 TGGAGGGCTGCTGCTTTTGCGGG - Intronic
957626894 3:82664651-82664673 TGGAGGGGTGCTGAAGTTTAGGG + Intergenic
968153804 3:196361274-196361296 GGGAGGGGGGTTGCTTCTTATGG + Intronic
972709447 4:41579910-41579932 TGCAGAGGAGCTGCTTTTTAAGG + Intronic
976198155 4:82552902-82552924 TGGAAGGGTGCTGCATCTTAGGG + Intronic
978296559 4:107211960-107211982 TGAAGCGGCTTTGCTTTTTATGG - Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980976526 4:139616410-139616432 TGGAAGATGGCTGCTTTTTAAGG - Intergenic
982967842 4:161936781-161936803 TGGTAGAGGGCTGCTTTTTATGG - Intronic
984024087 4:174522367-174522389 TGCAGAGGCGCTGCTGCTTAAGG - Exonic
987223680 5:15817669-15817691 TGCAGGGGAACTGCCTTTTATGG - Intronic
987496038 5:18645934-18645956 TGGAAAGGCGCAGCTTTTTGTGG - Intergenic
992159367 5:73985682-73985704 TGCAGGGCCACTGCTTTCTAGGG + Intergenic
993464981 5:88234057-88234079 TGGAGGGGCTTTGTTTTTTAAGG + Intronic
999916789 5:156271321-156271343 TGGAGGGGTCCTGCAGTTTATGG + Intronic
1005881751 6:30067490-30067512 CGGGGGGGCGGTGCTGTTTAGGG + Intronic
1019174850 6:170154624-170154646 TGGAGGGGCCCTGGGTTCTATGG - Intergenic
1019174873 6:170154685-170154707 TGGAGGGGCCCTGGGTTCTATGG - Intergenic
1019658761 7:2212002-2212024 TGCAGGAGCGATGCTTTTGAAGG - Intronic
1021521641 7:21544062-21544084 TGCAGGGGCCTTCCTTTTTAAGG - Intronic
1023719387 7:43077512-43077534 TGGAGGGGAGCTGCTGCTCACGG + Intergenic
1024262429 7:47582247-47582269 TGGAGGCGCGCTGCATTGTTAGG - Intronic
1024565994 7:50681400-50681422 TCGAGGGGCGATGGTGTTTATGG + Intronic
1027435469 7:78159697-78159719 AGGAGGGGTGCTTCCTTTTATGG - Intronic
1028087250 7:86651585-86651607 TAGAGGGTCTCTGCTTTTTCAGG - Intronic
1029011093 7:97263125-97263147 GAGAGGCGCTCTGCTTTTTAGGG + Intergenic
1031540841 7:122992891-122992913 TGGAGGGGAGGTGCCTTATAGGG - Intergenic
1035607071 8:936744-936766 TGGCAGGGAGCTGCTGTTTAAGG + Intergenic
1035785253 8:2254753-2254775 ATGTGGGGTGCTGCTTTTTAAGG + Intergenic
1035807555 8:2466963-2466985 ATGTGGGGTGCTGCTTTTTAAGG - Intergenic
1037419458 8:18686944-18686966 TGGAGCTGGGCTGCTGTTTAAGG - Intronic
1042354007 8:67806042-67806064 TGGAGGGGTGCTTCTTTATGAGG + Intergenic
1046714116 8:117548470-117548492 TGGTGGGGCAGTGCTTTCTAAGG + Intergenic
1047114710 8:121828465-121828487 AGGAGTGGCGCTGATTCTTACGG - Intergenic
1047154152 8:122298135-122298157 GAGAGGCGCTCTGCTTTTTAGGG + Intergenic
1048260619 8:132942077-132942099 TGGAGGTGCCCTTCTGTTTATGG + Intronic
1048626853 8:136195261-136195283 GAGAGGCGCTCTGCTTTTTAGGG + Intergenic
1049705245 8:144039229-144039251 TGGAGGAGTGCTCCTTTTTCTGG - Intronic
1060942442 9:127550688-127550710 TGGAGAGGCCCTGGTTTATATGG - Intronic
1062729073 9:138098406-138098428 TAGAGAGTCGCTGCTTTTTCTGG + Intronic
1191731358 X:64339204-64339226 TTAAGGGTCACTGCTTTTTAAGG - Intronic
1199412609 X:147542171-147542193 AGGAGGAGAGCTGCTATTTAAGG - Intergenic
1199873284 X:151915340-151915362 TGGAGGGGCCCCGGTTTTTGGGG - Intronic
1199873811 X:151917384-151917406 TGGAGGGGCCCCGGTTTTTGGGG - Intronic
1199873989 X:151918059-151918081 TGGAGGGGCCCCGGTTTTTGGGG - Intronic