ID: 927132717

View in Genome Browser
Species Human (GRCh38)
Location 2:20073982-20074004
Sequence TCCCTATGTTGAGGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927132717_927132722 8 Left 927132717 2:20073982-20074004 CCAGCCCTCCCTCAACATAGGGA No data
Right 927132722 2:20074013-20074035 ACAAAATTTCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927132717 Original CRISPR TCCCTATGTTGAGGGAGGGC TGG (reversed) Intergenic
No off target data available for this crispr