ID: 927134861

View in Genome Browser
Species Human (GRCh38)
Location 2:20089624-20089646
Sequence CAGTGAGAACATTATGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927134859_927134861 -5 Left 927134859 2:20089606-20089628 CCTTTGCAAAAATGATAACAGTG No data
Right 927134861 2:20089624-20089646 CAGTGAGAACATTATGGCAATGG No data
927134858_927134861 -2 Left 927134858 2:20089603-20089625 CCACCTTTGCAAAAATGATAACA No data
Right 927134861 2:20089624-20089646 CAGTGAGAACATTATGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927134861 Original CRISPR CAGTGAGAACATTATGGCAA TGG Intergenic
No off target data available for this crispr