ID: 927135954

View in Genome Browser
Species Human (GRCh38)
Location 2:20096689-20096711
Sequence CTATGAGAATGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927135954_927135959 -9 Left 927135954 2:20096689-20096711 CCCTCTGCCCTCCATTCTCATAG No data
Right 927135959 2:20096703-20096725 TTCTCATAGCCTACCTCAGATGG No data
927135954_927135962 12 Left 927135954 2:20096689-20096711 CCCTCTGCCCTCCATTCTCATAG No data
Right 927135962 2:20096724-20096746 GGCTTTCATCATCTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927135954 Original CRISPR CTATGAGAATGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr