ID: 927138621

View in Genome Browser
Species Human (GRCh38)
Location 2:20114891-20114913
Sequence TGGCCATTGCTGTAAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138621_927138633 28 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138633 2:20114942-20114964 GGCAACCCACCGTGGGGTCCTGG No data
927138621_927138631 22 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138631 2:20114936-20114958 CAACCAGGCAACCCACCGTGGGG No data
927138621_927138630 21 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data
927138621_927138625 7 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138625 2:20114921-20114943 ACCTGCAGTCCTTTCCAACCAGG No data
927138621_927138628 20 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138628 2:20114934-20114956 TCCAACCAGGCAACCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138621 Original CRISPR TGGCCATTGCTGTAAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr