ID: 927138625

View in Genome Browser
Species Human (GRCh38)
Location 2:20114921-20114943
Sequence ACCTGCAGTCCTTTCCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138621_927138625 7 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138625 2:20114921-20114943 ACCTGCAGTCCTTTCCAACCAGG No data
927138618_927138625 27 Left 927138618 2:20114871-20114893 CCTCTTTATTTCCTAGGAAGCCT No data
Right 927138625 2:20114921-20114943 ACCTGCAGTCCTTTCCAACCAGG No data
927138619_927138625 16 Left 927138619 2:20114882-20114904 CCTAGGAAGCCTCACACTTACAG No data
Right 927138625 2:20114921-20114943 ACCTGCAGTCCTTTCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138625 Original CRISPR ACCTGCAGTCCTTTCCAACC AGG Intergenic
No off target data available for this crispr