ID: 927138626

View in Genome Browser
Species Human (GRCh38)
Location 2:20114922-20114944
Sequence GCCTGGTTGGAAAGGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138626_927138637 11 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138637 2:20114956-20114978 GGGTCCTGGTGAAAACAGAGAGG No data
927138626_927138630 -10 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data
927138626_927138631 -9 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138631 2:20114936-20114958 CAACCAGGCAACCCACCGTGGGG No data
927138626_927138633 -3 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138633 2:20114942-20114964 GGCAACCCACCGTGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138626 Original CRISPR GCCTGGTTGGAAAGGACTGC AGG (reversed) Intergenic
No off target data available for this crispr