ID: 927138630

View in Genome Browser
Species Human (GRCh38)
Location 2:20114935-20114957
Sequence CCAACCAGGCAACCCACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138626_927138630 -10 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data
927138624_927138630 1 Left 927138624 2:20114911-20114933 CCAGGGACAGACCTGCAGTCCTT No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data
927138619_927138630 30 Left 927138619 2:20114882-20114904 CCTAGGAAGCCTCACACTTACAG No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data
927138621_927138630 21 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138630 2:20114935-20114957 CCAACCAGGCAACCCACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138630 Original CRISPR CCAACCAGGCAACCCACCGT GGG Intergenic
No off target data available for this crispr