ID: 927138633

View in Genome Browser
Species Human (GRCh38)
Location 2:20114942-20114964
Sequence GGCAACCCACCGTGGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138621_927138633 28 Left 927138621 2:20114891-20114913 CCTCACACTTACAGCAATGGCCA No data
Right 927138633 2:20114942-20114964 GGCAACCCACCGTGGGGTCCTGG No data
927138624_927138633 8 Left 927138624 2:20114911-20114933 CCAGGGACAGACCTGCAGTCCTT No data
Right 927138633 2:20114942-20114964 GGCAACCCACCGTGGGGTCCTGG No data
927138626_927138633 -3 Left 927138626 2:20114922-20114944 CCTGCAGTCCTTTCCAACCAGGC No data
Right 927138633 2:20114942-20114964 GGCAACCCACCGTGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138633 Original CRISPR GGCAACCCACCGTGGGGTCC TGG Intergenic
No off target data available for this crispr