ID: 927138974

View in Genome Browser
Species Human (GRCh38)
Location 2:20117211-20117233
Sequence CTCCTCGCTGTGCCCTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927138974_927138978 -5 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138978 2:20117229-20117251 AGGAGGCGGCTGTGGCCATCTGG No data
927138974_927138979 -2 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138979 2:20117232-20117254 AGGCGGCTGTGGCCATCTGGAGG No data
927138974_927138980 4 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138980 2:20117238-20117260 CTGTGGCCATCTGGAGGCAAAGG No data
927138974_927138982 11 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138982 2:20117245-20117267 CATCTGGAGGCAAAGGAGAGAGG No data
927138974_927138984 22 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138984 2:20117256-20117278 AAAGGAGAGAGGCCTCAGAAGGG No data
927138974_927138983 21 Left 927138974 2:20117211-20117233 CCATAGGAGGGCACAGCGAGGAG No data
Right 927138983 2:20117255-20117277 CAAAGGAGAGAGGCCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927138974 Original CRISPR CTCCTCGCTGTGCCCTCCTA TGG (reversed) Intergenic
No off target data available for this crispr