ID: 927143987

View in Genome Browser
Species Human (GRCh38)
Location 2:20148986-20149008
Sequence CCAAGCCAGCACTTTAAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927143987_927143991 5 Left 927143987 2:20148986-20149008 CCGACTTTAAAGTGCTGGCTTGG No data
Right 927143991 2:20149014-20149036 TGGTGGCCTCTCACACACATAGG No data
927143987_927143993 20 Left 927143987 2:20148986-20149008 CCGACTTTAAAGTGCTGGCTTGG No data
Right 927143993 2:20149029-20149051 CACATAGGCGCATATGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927143987 Original CRISPR CCAAGCCAGCACTTTAAAGT CGG (reversed) Intergenic
No off target data available for this crispr