ID: 927145184

View in Genome Browser
Species Human (GRCh38)
Location 2:20160356-20160378
Sequence ATTTAGTTCTTTAAGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927145182_927145184 18 Left 927145182 2:20160315-20160337 CCTACATTTTATCCTAATTCTTT No data
Right 927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG No data
927145183_927145184 6 Left 927145183 2:20160327-20160349 CCTAATTCTTTTGCAGTTTAAAA No data
Right 927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927145184 Original CRISPR ATTTAGTTCTTTAAGTAACC TGG Intergenic
No off target data available for this crispr