ID: 927146496

View in Genome Browser
Species Human (GRCh38)
Location 2:20169617-20169639
Sequence CGCCCTCTCCAGGAAACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146483_927146496 25 Left 927146483 2:20169569-20169591 CCCTATCTGGTCTTCCCCCACAG No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146482_927146496 28 Left 927146482 2:20169566-20169588 CCTCCCTATCTGGTCTTCCCCCA No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146489_927146496 10 Left 927146489 2:20169584-20169606 CCCCACAGGGACTGGTTCTTGTC No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146491_927146496 8 Left 927146491 2:20169586-20169608 CCACAGGGACTGGTTCTTGTCCA No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146488_927146496 11 Left 927146488 2:20169583-20169605 CCCCCACAGGGACTGGTTCTTGT No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146490_927146496 9 Left 927146490 2:20169585-20169607 CCCACAGGGACTGGTTCTTGTCC No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data
927146484_927146496 24 Left 927146484 2:20169570-20169592 CCTATCTGGTCTTCCCCCACAGG No data
Right 927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146496 Original CRISPR CGCCCTCTCCAGGAAACCTG TGG Intergenic
No off target data available for this crispr