ID: 927146736

View in Genome Browser
Species Human (GRCh38)
Location 2:20171116-20171138
Sequence GAGCAGAAGGAAAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146736_927146745 5 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146736_927146747 17 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146736_927146746 14 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146746 2:20171153-20171175 AACAGGTGCATCGGAACTGCAGG No data
927146736_927146748 29 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146748 2:20171168-20171190 ACTGCAGGAGGAAGAGAGTTTGG No data
927146736_927146741 -9 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146741 2:20171130-20171152 CTTCTGCTCACACCCGAAGGAGG No data
927146736_927146742 -3 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146736 Original CRISPR GAGCAGAAGGAAAAGAGGGC AGG (reversed) Intergenic