ID: 927146737

View in Genome Browser
Species Human (GRCh38)
Location 2:20171120-20171142
Sequence GTGTGAGCAGAAGGAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146737_927146745 1 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146737_927146748 25 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146748 2:20171168-20171190 ACTGCAGGAGGAAGAGAGTTTGG No data
927146737_927146746 10 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146746 2:20171153-20171175 AACAGGTGCATCGGAACTGCAGG No data
927146737_927146747 13 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146737_927146742 -7 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146737 Original CRISPR GTGTGAGCAGAAGGAAAAGA GGG (reversed) Intergenic