ID: 927146738

View in Genome Browser
Species Human (GRCh38)
Location 2:20171121-20171143
Sequence GGTGTGAGCAGAAGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146738_927146745 0 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146738_927146746 9 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146746 2:20171153-20171175 AACAGGTGCATCGGAACTGCAGG No data
927146738_927146748 24 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146748 2:20171168-20171190 ACTGCAGGAGGAAGAGAGTTTGG No data
927146738_927146747 12 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146738_927146742 -8 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146738 Original CRISPR GGTGTGAGCAGAAGGAAAAG AGG (reversed) Intergenic