ID: 927146740

View in Genome Browser
Species Human (GRCh38)
Location 2:20171129-20171151
Sequence CTCCTTCGGGTGTGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146740_927146748 16 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146748 2:20171168-20171190 ACTGCAGGAGGAAGAGAGTTTGG No data
927146740_927146749 28 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146749 2:20171180-20171202 AGAGAGTTTGGAAAAGTCCCTGG No data
927146740_927146746 1 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146746 2:20171153-20171175 AACAGGTGCATCGGAACTGCAGG No data
927146740_927146747 4 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146740_927146745 -8 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146740 Original CRISPR CTCCTTCGGGTGTGAGCAGA AGG (reversed) Intergenic