ID: 927146741

View in Genome Browser
Species Human (GRCh38)
Location 2:20171130-20171152
Sequence CTTCTGCTCACACCCGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146736_927146741 -9 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146741 2:20171130-20171152 CTTCTGCTCACACCCGAAGGAGG No data
927146735_927146741 -8 Left 927146735 2:20171115-20171137 CCCTGCCCTCTTTTCCTTCTGCT No data
Right 927146741 2:20171130-20171152 CTTCTGCTCACACCCGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146741 Original CRISPR CTTCTGCTCACACCCGAAGG AGG Intergenic
No off target data available for this crispr